ID: 1064309816

View in Genome Browser
Species Human (GRCh38)
Location 10:14202200-14202222
Sequence GCTGCAAGACAGTGGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064309812_1064309816 10 Left 1064309812 10:14202167-14202189 CCATTGGATTCTGGTAAACTAAG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1064309816 10:14202200-14202222 GCTGCAAGACAGTGGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064309816 Original CRISPR GCTGCAAGACAGTGGCAGGC AGG Intronic
No off target data available for this crispr