ID: 1064311955

View in Genome Browser
Species Human (GRCh38)
Location 10:14219684-14219706
Sequence TTCTCTGAAGGTGTTACATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064311955_1064311967 16 Left 1064311955 10:14219684-14219706 CCCCATGTAACACCTTCAGAGAA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1064311967 10:14219723-14219745 AGAAGTGCCCAGGGCAAGCTGGG No data
1064311955_1064311966 15 Left 1064311955 10:14219684-14219706 CCCCATGTAACACCTTCAGAGAA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1064311966 10:14219722-14219744 CAGAAGTGCCCAGGGCAAGCTGG No data
1064311955_1064311968 19 Left 1064311955 10:14219684-14219706 CCCCATGTAACACCTTCAGAGAA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1064311968 10:14219726-14219748 AGTGCCCAGGGCAAGCTGGGAGG No data
1064311955_1064311964 6 Left 1064311955 10:14219684-14219706 CCCCATGTAACACCTTCAGAGAA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1064311964 10:14219713-14219735 GGGGAACTTCAGAAGTGCCCAGG No data
1064311955_1064311965 7 Left 1064311955 10:14219684-14219706 CCCCATGTAACACCTTCAGAGAA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1064311965 10:14219714-14219736 GGGAACTTCAGAAGTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064311955 Original CRISPR TTCTCTGAAGGTGTTACATG GGG (reversed) Intronic
900857968 1:5201171-5201193 TTCTCTGCAGGTGGCTCATGTGG - Intergenic
901369799 1:8787282-8787304 TTCTCTGAAGAGGTGACATTTGG - Intronic
902552015 1:17224828-17224850 TACTCTTCAGGTGTTACCTGGGG - Intronic
904807652 1:33143089-33143111 TTCACTTAATGTGTTAAATGTGG + Intergenic
905490106 1:38336963-38336985 TTCTCTGGAGATGTTCCCTGGGG - Intergenic
907824960 1:58006801-58006823 TCCTGTGAAGGTGAAACATGTGG + Intronic
908826712 1:68140326-68140348 TGCTCTGAAGGTAGCACATGAGG + Intronic
910978803 1:92937949-92937971 TTCTGTGAAGCTGTGACCTGGGG - Intronic
914247524 1:145897124-145897146 TCCTCTGTAGTTGTTCCATGAGG - Intronic
914432452 1:147631327-147631349 TTTGCTGATGGTTTTACATGAGG - Intronic
915494654 1:156273190-156273212 TTTTCTGAGTGTGTTACAAGAGG + Intronic
921727014 1:218535001-218535023 TTCTCTCAAGGTGATAGATGGGG + Intergenic
1064311955 10:14219684-14219706 TTCTCTGAAGGTGTTACATGGGG - Intronic
1064932644 10:20643841-20643863 TTCTCTGAAGAGGTGACATGAGG - Intergenic
1065269410 10:24011907-24011929 ATCTGTGAAGATGTTTCATGTGG + Intronic
1068015340 10:51509318-51509340 ATTTTTGAATGTGTTACATGGGG + Intronic
1071888794 10:89980013-89980035 TTCTCTGAAGGTCTTCCAACTGG + Intergenic
1071971555 10:90913035-90913057 TTCTCTGTGTGTGTTTCATGAGG + Intronic
1073634743 10:105186235-105186257 TTTTCTGATTGTTTTACATGTGG + Intronic
1076581012 10:131511086-131511108 TTATCTGTAGCTGTTACATTTGG + Intergenic
1076679125 10:132162605-132162627 ATCTCTGAAGATGTTACATTTGG + Intronic
1078795202 11:14585504-14585526 TTCTCTGAAGTTCTTAAAAGGGG - Intronic
1079162403 11:18007366-18007388 GTTTCTGAATCTGTTACATGAGG - Intronic
1084621514 11:70273300-70273322 TTCTCTGAGTATGTTACATTTGG + Intronic
1086663227 11:89447864-89447886 ACCTCTGCAGGTGTTAGATGGGG - Intronic
1090471022 11:126981423-126981445 TGCTCAGGAGGTGTTATATGTGG + Intronic
1090697802 11:129266523-129266545 TTCTCTGAATGTGTTACAGATGG - Intronic
1092051503 12:5474023-5474045 TTCTCTGAAGGCCTTCCATATGG - Intronic
1096227779 12:49877456-49877478 TTCTCGCAATGCGTTACATGAGG - Intronic
1103539896 12:121658850-121658872 TTCTCAGAAAGTGATACCTGGGG + Intronic
1108148051 13:47500632-47500654 CTAACTGAAGGTGTTTCATGTGG + Intergenic
1108246077 13:48515699-48515721 ATCTTTGAAGATGTTAGATGTGG - Exonic
1111044302 13:82795040-82795062 TTGACTGATGGTATTACATGTGG - Intergenic
1112655623 13:101449833-101449855 TTCTCTGATTGTGTAACCTGAGG + Intergenic
1115143721 14:30202756-30202778 TGCTCTGAAGATTTTATATGTGG + Intergenic
1115672797 14:35634512-35634534 TTCTCTCAAGGTATAACTTGAGG - Intronic
1116960768 14:50965866-50965888 CTCTCTGAAGGGGTTATATTTGG - Intergenic
1117283743 14:54265904-54265926 TTCTCTGAAGCTGTGATATTTGG - Intergenic
1119258545 14:73221433-73221455 TTCTCTGAAGAGGGTACGTGGGG + Exonic
1121033297 14:90677642-90677664 TCCTGTGAAAGTGGTACATGAGG + Intronic
1121607300 14:95250575-95250597 TTTTGTGAAGAAGTTACATGTGG - Intronic
1122291764 14:100684588-100684610 TTTCCTGAAGGTGTTCCACGCGG + Intergenic
1128393910 15:67203799-67203821 TTCTTTCAATGTGTTACATAAGG - Intronic
1128597806 15:68967593-68967615 TTCTCTGAATTTCTTACATCTGG + Intronic
1128844155 15:70874677-70874699 TTCCCTGAAGGTGTTATAGCTGG - Intronic
1133259200 16:4537798-4537820 TTCTCAACAGGTGTTAGATGAGG - Intronic
1134189735 16:12111875-12111897 TTCTCTGAAGATCTGAGATGGGG + Intronic
1134806139 16:17127061-17127083 TTCTCTGAAGGTGTATCATTTGG + Intronic
1135233126 16:20728475-20728497 TTCTCTGAATATGTGATATGAGG + Intronic
1136622272 16:31437039-31437061 TCATCTGAAGGTGTTTCTTGAGG + Exonic
1137749968 16:50853819-50853841 TTCTGTGAGGGTGTTTCTTGAGG + Intergenic
1140161699 16:72502528-72502550 TTCATGGAAGGTGTTACTTGAGG + Intergenic
1147766416 17:42839450-42839472 TTCTCTGAAGGGCTGAGATGAGG + Intronic
1148150338 17:45393346-45393368 TGCTCGGAAGGTGTGTCATGGGG - Intergenic
1150842873 17:68625579-68625601 TGCTATGGAGGTGTTACTTGGGG - Intergenic
1153142900 18:1995237-1995259 TCCTTTGAAGGTGTTGCCTGAGG + Intergenic
1154997048 18:21650194-21650216 TTCTCTCAACGTGTTACCTGAGG + Intergenic
1156209045 18:34919279-34919301 TTTGCTGAAGGTGTTATCTGGGG - Intergenic
1156735894 18:40259190-40259212 TTATCTGAAGATGTAACAGGAGG - Intergenic
1158104991 18:53875480-53875502 TGCTATGAAGGTGATACATTGGG - Intergenic
1160987026 19:1843770-1843792 GTCTCTGAAGGTGACACAGGTGG + Intronic
1162101172 19:8340045-8340067 CTCCCTGAAGGTTTTCCATGTGG - Intronic
1166429213 19:42709928-42709950 TTCTCTGAAGAGGTTTCAGGAGG - Intronic
1166432346 19:42738361-42738383 TTCTCTGAGAGTATTTCATGGGG + Intronic
1166442867 19:42831250-42831272 TTCTCTGAAGAGGTTTCAGGAGG - Intronic
1166450648 19:42897677-42897699 TTCTCTGAAGAGGTTTCAGGAGG - Intronic
1166462548 19:43002012-43002034 TTCTCTGAAGACGTTTCAGGAGG - Intronic
1166468685 19:43058473-43058495 TTCTCTGAAGACGTTTCAGGAGG - Intronic
1168516994 19:57017179-57017201 TGCTCTGAAGGTGTCAGATTTGG - Intergenic
925417135 2:3678275-3678297 TTCTCTGAAGATGATAAAAGCGG + Intronic
926832139 2:16975447-16975469 TTCTCTGAAGGGGTACAATGAGG - Intergenic
928948539 2:36793357-36793379 TTCTCTGATGGTGGGAAATGTGG + Intronic
929164475 2:38867463-38867485 TCATCTGATGGTGTTACATGTGG - Intronic
929888920 2:45903661-45903683 TTCCCTGAACATCTTACATGGGG - Intronic
938748142 2:134300709-134300731 GTCACTGAAGGTGTTATTTGAGG + Intronic
946542860 2:220704794-220704816 TTCTCTGAAGTTGTTAGAGGGGG + Intergenic
946979779 2:225197552-225197574 TTCTCTGAAGGTGCTAGATTAGG + Intergenic
1169042502 20:2508068-2508090 TTGTCTCAAGGTGTGTCATGTGG - Intronic
1169239991 20:3968684-3968706 TTTGCAGAAGGTGTTTCATGTGG - Intronic
1169513506 20:6291804-6291826 TTCACTCAGGGTGTCACATGAGG + Intergenic
1169604558 20:7302226-7302248 TCCTCTTCAGGTGTTACGTGAGG - Intergenic
1172112769 20:32557048-32557070 TTTTCTGCAGCTGTTACAGGGGG + Intronic
1175620748 20:60445190-60445212 TTTTCAGAAAATGTTACATGCGG + Intergenic
949620902 3:5810478-5810500 TTTTCCAAAGGTGTGACATGAGG + Intergenic
950143781 3:10633554-10633576 TTCTCTGATGGTAATACATGGGG + Intronic
952311313 3:32192816-32192838 TTCTCTGAATGTGTCCTATGTGG + Intergenic
954128780 3:48549097-48549119 TTCTCAGGAGGTGTTAGCTGTGG - Intronic
957502875 3:81079768-81079790 ATCTCTGAGGTTGTTTCATGAGG - Intergenic
957631841 3:82725917-82725939 TTCTATGTAGGTGTGACCTGAGG - Intergenic
959882208 3:111456691-111456713 TTCTCTTTAGTTGTTGCATGGGG + Intronic
962115314 3:132499724-132499746 TCCTCTGCAGGTGTTACAAGAGG + Exonic
965304831 3:167051501-167051523 TTCTCTGAATGTGTTAAACCAGG + Intergenic
965910131 3:173764472-173764494 TTATCTGAAGGTCTGCCATGTGG + Intronic
966178574 3:177166539-177166561 TTCTCTGATGGTTTTATATGGGG + Intronic
970146766 4:13044088-13044110 TTCTTTGAAGCTGCTAAATGTGG + Intergenic
970168196 4:13262197-13262219 CTCTCTGAGGGTCTGACATGGGG - Intergenic
970970524 4:21978301-21978323 TTCTCTGAATGTATGACAAGAGG - Intergenic
971237596 4:24856746-24856768 TTAGCTCAAGGTGTCACATGTGG + Intronic
972351667 4:38242030-38242052 TTCCAGGGAGGTGTTACATGGGG + Intergenic
974017329 4:56659433-56659455 TACTCTGAAGGTGGTAGAAGGGG + Intronic
977731287 4:100355750-100355772 TTCTCTGAAGGAATGACATAAGG - Intergenic
978141804 4:105326295-105326317 TTCCCTGAAGAAGTTACATTTGG - Intergenic
984373787 4:178900688-178900710 TTATCTGAAGGTGTAATATCAGG + Intergenic
984922303 4:184776439-184776461 TTCTCTGAAGGCTTTCCCTGGGG - Intronic
989341643 5:40382379-40382401 TTCTCTGAAGGAGGTAAAAGAGG - Intergenic
990194685 5:53301414-53301436 TTCTCTGAAGGTTCTAGAGGAGG + Intergenic
990680071 5:58232792-58232814 TTCTCTGAAAATGCTCCATGTGG - Intergenic
994557591 5:101323498-101323520 TTCTCTGAAGGGGAAACATCAGG + Intergenic
996009615 5:118467465-118467487 TTCTCTGAAGATTTCACAGGAGG - Intergenic
996271775 5:121614255-121614277 TTTTCTGAAGGCATTACATGGGG + Intergenic
996324425 5:122256887-122256909 TTCTCTGAATTTCTTATATGTGG + Intergenic
996605039 5:125312009-125312031 TTCTCTGAATGTGTAACTGGAGG + Intergenic
999178698 5:149653065-149653087 TTCTCTCAAGGTGAGACTTGAGG - Intergenic
1000469110 5:161617630-161617652 TATTCTGAAGGTGTTCCAGGTGG - Intronic
1001104161 5:168839098-168839120 TCCTCAGAAGGTGAGACATGAGG + Intronic
1007816193 6:44527293-44527315 TTCTGTGAAGATGTAACATTTGG + Intergenic
1008040281 6:46790156-46790178 TTCTCTGAAGGTATCGGATGGGG - Intergenic
1008794631 6:55287639-55287661 GTTTCTGAAGGTGTCACAAGCGG - Intergenic
1009737971 6:67703464-67703486 TTTTCAGAAGGTGTTTCATAGGG - Intergenic
1009792835 6:68425097-68425119 TTTTCTTAATGTTTTACATGTGG + Intergenic
1011529445 6:88304175-88304197 TTCTCTGATGGTGTCACATCTGG - Intergenic
1021085108 7:16413310-16413332 TATTTTGAAGGTGTTCCATGCGG + Intronic
1022826886 7:34023713-34023735 TCCTATGAAAGTGTTACAGGAGG - Intronic
1023122786 7:36926121-36926143 TTTCCTGAACGTGTTACATAAGG + Intronic
1025308898 7:57900862-57900884 TTCTGTATAGTTGTTACATGAGG - Intergenic
1027761068 7:82279334-82279356 TTATCTGAAGTTATTACAAGTGG + Intronic
1027834635 7:83224543-83224565 TTCTCTCAAGGTGGTACACTGGG - Intergenic
1028392843 7:90335615-90335637 GTTTCTGAAGGTGTTACTGGTGG - Intronic
1030822120 7:114106774-114106796 TTCTCTGAGGCTATTAGATGTGG + Intronic
1031090788 7:117351317-117351339 TTCTCTAAATCTGTTACTTGTGG + Intergenic
1031257198 7:119468739-119468761 TTCTCTGTAGATTTTCCATGGGG + Intergenic
1032877305 7:136051362-136051384 TTCTCTGAAGGTGGAACAAAGGG - Intergenic
1033330728 7:140414900-140414922 GCCTCTGAGGGTTTTACATGGGG - Intronic
1033614058 7:142994321-142994343 TTCTCTGCAGTTGTTTCTTGTGG - Intergenic
1033995301 7:147338347-147338369 TTCTGTGAATTTTTTACATGAGG - Intronic
1036280410 8:7395550-7395572 TGCTCTGAAGGAGTCACATCGGG - Intergenic
1036341060 8:7916020-7916042 TGCTCTGAAGGAGTCACATCGGG + Intergenic
1037470029 8:19198988-19199010 TTCTCTGAACATGTTACCTTTGG - Intergenic
1038169672 8:25117876-25117898 TTCTCTGTAAGTGATACATTAGG + Intergenic
1038944950 8:32348848-32348870 TTTTCTGAAGGTGATTCATATGG + Intronic
1040113131 8:43582488-43582510 TTCTTTGTAGTTTTTACATGTGG - Intergenic
1042396516 8:68297153-68297175 ATCTCTGAAGTTGTTGCATAGGG + Intergenic
1042866216 8:73358721-73358743 CACCCTGAAGGTGTAACATGAGG + Intergenic
1045530879 8:102984266-102984288 TTATCTCAAGGTGTTTAATGGGG + Intergenic
1046286907 8:112105800-112105822 GTTTCTGATGGTGTTGCATGAGG + Intergenic
1046406971 8:113786951-113786973 TTCTTTGAAGGTATTAATTGAGG - Intergenic
1050765021 9:9122001-9122023 TTCCCAGAATTTGTTACATGAGG + Intronic
1052385586 9:27820025-27820047 TTCACTGAAGGTGTTATTCGAGG + Intergenic
1055280109 9:74664442-74664464 TTTTATGGAGGAGTTACATGAGG - Intronic
1055773508 9:79742791-79742813 TTCTCTGAATGTGCTCCTTGAGG + Intergenic
1055922214 9:81472848-81472870 TTCTCTGAAAGTGGAACACGCGG - Intergenic
1057997287 9:99829547-99829569 TTCTCTGAAGGTGTGTCCTGAGG - Intronic
1058966874 9:110047354-110047376 TTCTCTGAAGGTGCTATTTATGG + Intronic
1059507225 9:114810560-114810582 TTCTCTTCATGTGTTAAATGGGG + Intergenic
1059750236 9:117240723-117240745 ATCTCTGAAAGTGTTTCCTGAGG + Intronic
1060271270 9:122143768-122143790 TTCTCTAAAGGTCATACAAGGGG - Intergenic
1060879449 9:127107884-127107906 TTCTGGGATCGTGTTACATGTGG - Intronic
1187233398 X:17443882-17443904 TACTCTTAAGCAGTTACATGTGG + Intronic
1189605312 X:42671766-42671788 TTCTCTGAGGTGGTTACATTTGG + Intergenic
1191261879 X:58331931-58331953 TTCTCTGTGGGTTTTATATGGGG - Intergenic
1195228577 X:102823338-102823360 TGCTCAGAAGGTGGGACATGGGG - Intergenic
1196793116 X:119482046-119482068 TCATCTGCAGGTGTTACACGTGG - Intergenic
1198124906 X:133633678-133633700 CTCTCTGTAGTTGTTTCATGAGG - Intronic
1198869032 X:141156411-141156433 GTCTGTGAAGGTGTTACCAGAGG + Intergenic
1199619552 X:149686927-149686949 TTGTCTGATGGTTTTATATGGGG + Intergenic