ID: 1064311956

View in Genome Browser
Species Human (GRCh38)
Location 10:14219685-14219707
Sequence CTTCTCTGAAGGTGTTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064311956_1064311968 18 Left 1064311956 10:14219685-14219707 CCCATGTAACACCTTCAGAGAAG 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1064311968 10:14219726-14219748 AGTGCCCAGGGCAAGCTGGGAGG No data
1064311956_1064311967 15 Left 1064311956 10:14219685-14219707 CCCATGTAACACCTTCAGAGAAG 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1064311967 10:14219723-14219745 AGAAGTGCCCAGGGCAAGCTGGG No data
1064311956_1064311965 6 Left 1064311956 10:14219685-14219707 CCCATGTAACACCTTCAGAGAAG 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1064311965 10:14219714-14219736 GGGAACTTCAGAAGTGCCCAGGG No data
1064311956_1064311966 14 Left 1064311956 10:14219685-14219707 CCCATGTAACACCTTCAGAGAAG 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1064311966 10:14219722-14219744 CAGAAGTGCCCAGGGCAAGCTGG No data
1064311956_1064311964 5 Left 1064311956 10:14219685-14219707 CCCATGTAACACCTTCAGAGAAG 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1064311964 10:14219713-14219735 GGGGAACTTCAGAAGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064311956 Original CRISPR CTTCTCTGAAGGTGTTACAT GGG (reversed) Intronic
900364096 1:2303745-2303767 CCCCTCTGAAGGTGTTAAACAGG - Intronic
905490107 1:38336964-38336986 CTTCTCTGGAGATGTTCCCTGGG - Intergenic
906755451 1:48310096-48310118 TTTCTTTGAAGGTTTTTCATTGG + Intronic
906942463 1:50267479-50267501 CCTCTCTGGAGGTGATGCATAGG - Intergenic
910050469 1:82967909-82967931 CTTCACTCAAGGTGATACTTGGG + Intergenic
910452288 1:87359623-87359645 TTTCTTTGAGGGTGTTACTTTGG + Intergenic
911816093 1:102353165-102353187 CTTCTCTAAAAGTGATAAATTGG - Intergenic
915473733 1:156140372-156140394 CTTCTCTGAAGGACTTCCGTTGG - Intergenic
918828954 1:189366355-189366377 CTTCTCTATAGGTGCTACAATGG - Intergenic
918850683 1:189685453-189685475 GTTCTGTGAAGGTGTAATATTGG + Intergenic
921727013 1:218535000-218535022 TTTCTCTCAAGGTGATAGATGGG + Intergenic
923255098 1:232215161-232215183 CTTCTCTGAAGATGATGCAGAGG + Intergenic
924838080 1:247675525-247675547 CTTCTCTGGAGTTATGACATTGG + Intergenic
1064311956 10:14219685-14219707 CTTCTCTGAAGGTGTTACATGGG - Intronic
1064893892 10:20211658-20211680 CTTCTTTGAAGATGTTCCAGTGG + Exonic
1065472297 10:26094968-26094990 CTTTTCTGAAAGTATTTCATTGG + Intronic
1069666968 10:70169406-70169428 CTTCTCGTAAGGTGGTACAATGG - Intronic
1071016546 10:81003889-81003911 CTTCTCTGAAGTGGATACATTGG + Intergenic
1074554501 10:114475982-114476004 CTTGTCTGAAGGAGTTTCTTTGG - Intronic
1075607530 10:123824075-123824097 CTGCTCTGAATGTGTAACAGAGG - Intronic
1076030547 10:127154094-127154116 CTTAGCTGTAGGTGTTGCATTGG - Intronic
1076930072 10:133526450-133526472 CTTCTATGAAGGTAGTCCATAGG - Intronic
1080057010 11:27916885-27916907 CTTCTCTCATGGTTTTACAATGG - Intergenic
1081522092 11:43891892-43891914 CTTCTGTGAAGGTGGAACTTTGG + Intronic
1085465801 11:76722453-76722475 CTTCACAGAAGGGGTGACATTGG - Intergenic
1086663228 11:89447865-89447887 CACCTCTGCAGGTGTTAGATGGG - Intronic
1090372634 11:126267477-126267499 CCTCTCTGAAGGTGGTTCAAAGG - Intronic
1095482613 12:42651628-42651650 CTTCTCTGAAGCTGTTTCTAGGG - Intergenic
1098051445 12:66458263-66458285 CATGTCTGAAGGTGTTACAGTGG - Intronic
1099542095 12:83924702-83924724 CTTATCTGGAAGTGTAACATTGG + Intergenic
1101885623 12:108658962-108658984 GTTTTCTGAGTGTGTTACATAGG - Intronic
1104483328 12:129127933-129127955 CTTCTGTGCAGCTGTCACATGGG + Intronic
1105221643 13:18334797-18334819 CTTTTCTTAATCTGTTACATAGG + Intergenic
1105767718 13:23578353-23578375 CCTCTATCAAGGTGTGACATCGG + Intronic
1109603035 13:64657842-64657864 CTTCTCTTCAGGTGTTCCTTTGG - Intergenic
1110682633 13:78334447-78334469 TTTCTGTGAAGTTGTGACATAGG - Intergenic
1112936821 13:104810676-104810698 TGTCTCTGAAGTTGTTCCATGGG - Intergenic
1113128387 13:107006547-107006569 CCTTTCAGAAAGTGTTACATTGG - Intergenic
1118172914 14:63406796-63406818 GTTCTCTTAAGATGTTACATGGG - Intronic
1118300944 14:64615387-64615409 CTTCTCTAAAGGTATCACAAAGG - Intergenic
1119258544 14:73221432-73221454 CTTCTCTGAAGAGGGTACGTGGG + Exonic
1125852210 15:42914647-42914669 CTTGTCTAAAGCTGTTTCATGGG + Intronic
1130744506 15:86636417-86636439 CTTCTCTGTATGTTTTAAATCGG - Intronic
1130882430 15:88066775-88066797 CTTCTCTGTGGTTCTTACATTGG + Intronic
1133342403 16:5045206-5045228 CATCTCAGAAGGTCTTACACAGG - Intronic
1133985935 16:10668320-10668342 CTTCTCTGATGGTGTCACGGAGG - Intronic
1134189734 16:12111874-12111896 CTTCTCTGAAGATCTGAGATGGG + Intronic
1135873474 16:26174321-26174343 GTTCACTGAAGGTTTTACATAGG + Intergenic
1137520599 16:49191912-49191934 CTTCTCTGAAAATATTAGATGGG + Intergenic
1137546867 16:49410817-49410839 CTTCTCTGGAGGAGTCACAGGGG + Intergenic
1145877729 17:28332177-28332199 CTGCTCTGAAGGAGTGACAGTGG + Exonic
1148590711 17:48814736-48814758 CTTCCCTGGAGGTGTTGCAGAGG + Intronic
1150281812 17:63933264-63933286 CATCTCTGAAGGGGCTGCATTGG - Intergenic
1150842874 17:68625580-68625602 CTGCTATGGAGGTGTTACTTGGG - Intergenic
1153698983 18:7673594-7673616 TTTCTGTGAAGATGATACATAGG + Intronic
1153947307 18:10029305-10029327 ATTCTCTGAAGGATTTACACAGG - Intergenic
1156209046 18:34919280-34919302 CTTTGCTGAAGGTGTTATCTGGG - Intergenic
1158104992 18:53875481-53875503 ATGCTATGAAGGTGATACATTGG - Intergenic
1159713979 18:71798366-71798388 CACCCCTTAAGGTGTTACATTGG - Intergenic
1166253936 19:41589249-41589271 CTTCTCTGTGGGTGTGACGTGGG - Intronic
1166432345 19:42738360-42738382 CTTCTCTGAGAGTATTTCATGGG + Intronic
1166840973 19:45696811-45696833 CCTCTTTGAAGGGGTGACATTGG - Intronic
1167569876 19:50280393-50280415 CCTCCCTGAAGGTCTTACGTAGG - Intronic
929888921 2:45903662-45903684 CTTCCCTGAACATCTTACATGGG - Intronic
932683183 2:73844912-73844934 CTGCTCTGAAGCTTTTAGATGGG - Intronic
932906925 2:75764113-75764135 CCATTCTGGAGGTGTTACATTGG - Intergenic
935309318 2:101767618-101767640 CATCTCTAAAGGTGAGACATTGG - Intronic
939648649 2:144734666-144734688 CTTCTCTGAGGAAGTGACATTGG + Intergenic
939677979 2:145095966-145095988 CTTGTCTGATTGTGCTACATTGG + Intergenic
939698596 2:145360199-145360221 ATTCTCTGAAGCTTTTACACAGG - Intergenic
941128495 2:161616798-161616820 CTTCTCTGAAGGAGAGACAGTGG + Intronic
941870641 2:170381566-170381588 AATCTCTGAAAGTGTTACGTAGG + Intronic
942588688 2:177516300-177516322 CTTTTCTGAAGACGTTATATGGG + Intronic
946542859 2:220704793-220704815 TTTCTCTGAAGTTGTTAGAGGGG + Intergenic
947346919 2:229201340-229201362 CTTTTCTGAAGTTCTTACAGTGG - Intronic
1172112768 20:32557047-32557069 CTTTTCTGCAGCTGTTACAGGGG + Intronic
1177493793 21:21862827-21862849 CTTCTCCTAACTTGTTACATTGG - Intergenic
1180717602 22:17882361-17882383 CTTCTCTGGAGGTGGTTCAGAGG - Intronic
1181469845 22:23131558-23131580 CTTCTCTGAATGCTTTAAATAGG + Intronic
1182055385 22:27349467-27349489 CTTCTCTGAAAGTGATAAATTGG - Intergenic
1184630364 22:45773393-45773415 CTTCTCTGTGGGGGTTAAATGGG + Intronic
1184928329 22:47660127-47660149 CTTCTCTGAAGGGCTCACAAAGG + Intergenic
949512406 3:4778167-4778189 CTTCTATGTAGGGGTTCCATAGG + Intronic
950143780 3:10633553-10633575 CTTCTCTGATGGTAATACATGGG + Intronic
954534411 3:51348174-51348196 CTTCTCTCAGGCTGTTGCATGGG + Intronic
954574484 3:51668221-51668243 CCTCTCTGAAGATGGTACAAGGG - Exonic
954889688 3:53913710-53913732 CCTCTCTGAAAGTGATAAATTGG - Intergenic
959313673 3:104774459-104774481 TGTATCTGAAGGTGTCACATCGG - Intergenic
966178573 3:177166538-177166560 GTTCTCTGATGGTTTTATATGGG + Intronic
967491892 3:190101794-190101816 CTTCTTGGAAGATGTCACATAGG + Intronic
970168197 4:13262198-13262220 CCTCTCTGAGGGTCTGACATGGG - Intergenic
972351666 4:38242029-38242051 CTTCCAGGGAGGTGTTACATGGG + Intergenic
973082027 4:46004971-46004993 TTTCTCAGAAGGTGTTCCCTTGG + Intergenic
974196947 4:58587282-58587304 CTTCTCTAAAAGTGTACCATCGG + Intergenic
974664297 4:64937730-64937752 CCTCTCTGAAAGTGATAAATTGG - Intergenic
975118845 4:70706506-70706528 CTTCTCTTAAGCTGTTACTTGGG - Intronic
975314373 4:72934131-72934153 TTTCTCTGGAGGGGGTACATTGG + Intergenic
976299036 4:83500711-83500733 CCTCTCTAAAAGTGATACATTGG - Intronic
977195228 4:94050211-94050233 CTTCTTTGAAGGTTTTACACTGG - Intergenic
978931917 4:114324616-114324638 CCTCTCTAAAAGTGTTAAATTGG + Intergenic
978953796 4:114592489-114592511 CATATCTGAAGGTGTCAGATGGG - Intergenic
981857644 4:149313393-149313415 CTTCTCTGAATGATTGACATTGG - Intergenic
982012747 4:151122685-151122707 CCTCACTGAAGGTGTCATATAGG + Intronic
984922304 4:184776440-184776462 CTTCTCTGAAGGCTTTCCCTGGG - Intronic
987612066 5:20218497-20218519 CTGCTCTTAAGGTATCACATAGG - Intronic
991092829 5:62709657-62709679 CTTCTGTTAAGATGATACATAGG - Intergenic
991113718 5:62929816-62929838 CTTTGCTGAATGTGTTTCATCGG - Intergenic
991231656 5:64340409-64340431 TTTGCCTGAAGGTGTTAGATTGG + Intronic
993187618 5:84640132-84640154 CTTCTCTGAAGTTGTTAATGGGG + Intergenic
995410125 5:111847708-111847730 CTTCTCTGAATGTGAGACCTGGG + Intronic
995855909 5:116592078-116592100 CCCCTCTGAAGTTTTTACATCGG - Intergenic
996266455 5:121546935-121546957 CCTCTCTGAAGGTCTAAGATTGG - Intergenic
996271774 5:121614254-121614276 CTTTTCTGAAGGCATTACATGGG + Intergenic
998411236 5:141913160-141913182 CTTCTCTGCATGTACTACATGGG - Intergenic
1000681206 5:164187350-164187372 CCTCTCTGAAGGCCTTACTTGGG - Intergenic
1001917037 5:175570404-175570426 CTGCTCTGAGGATGTGACATTGG + Intergenic
1007123251 6:39401178-39401200 CTTCTAGGAAGTTGTTACAGTGG + Intronic
1007205800 6:40149482-40149504 ATTTTCTGATGGTGTTAGATTGG + Intergenic
1009494524 6:64331025-64331047 CATATCTGAAGGTGTCAGATGGG + Intronic
1009737972 6:67703465-67703487 ATTTTCAGAAGGTGTTTCATAGG - Intergenic
1011017278 6:82770832-82770854 TCTCTCTGAAGCTGTTATATGGG - Intergenic
1012488895 6:99756106-99756128 ATTATCTGAAGATGCTACATTGG - Intergenic
1013719066 6:113000901-113000923 CTTCTCTGAAGTTACTACCTGGG + Intergenic
1015896865 6:138026058-138026080 CTTCTCTGAAGGAGCAAGATTGG + Intergenic
1018559167 6:165083624-165083646 CCTCTCTAAAAGTGATACATTGG + Intergenic
1018765104 6:166926734-166926756 CTGGTCTGAAGGAGTTTCATGGG + Intronic
1019263875 7:101357-101379 CTTCCCTGAGGGTGTTCCAAAGG + Intergenic
1019291957 7:255089-255111 CTTCTCTTAGGGGTTTACATGGG + Intronic
1020180005 7:5914935-5914957 CTTTCCTGAGGGTGTTACACAGG + Intronic
1021055822 7:16044708-16044730 CTTCTCTGAAGCTCTTATAATGG + Intergenic
1022767848 7:33435169-33435191 CTTCTCTGTAGGTTCTGCATTGG + Intronic
1024239103 7:47420307-47420329 CCTCTCTGAAAGTGATACACTGG + Intronic
1027834636 7:83224544-83224566 ATTCTCTCAAGGTGGTACACTGG - Intergenic
1028377867 7:90166259-90166281 CTTTTCTGAAGTTTTTACAATGG + Intergenic
1032585569 7:133143099-133143121 CCTCTGTGAAGGTGTAACTTTGG + Intergenic
1032877306 7:136051363-136051385 CTTCTCTGAAGGTGGAACAAAGG - Intergenic
1033873315 7:145784405-145784427 CCTCTCTAAAAGTGATACATTGG + Intergenic
1035566728 8:646079-646101 TTTCTCTGAAGGTTTGGCATTGG + Intronic
1036280411 8:7395551-7395573 CTGCTCTGAAGGAGTCACATCGG - Intergenic
1036341059 8:7916019-7916041 CTGCTCTGAAGGAGTCACATCGG + Intergenic
1038746623 8:30260500-30260522 ATTCACTGCAGGTGTTACTTTGG - Intergenic
1040137490 8:43871749-43871771 CTTCTCTCCAGGTTTTACCTCGG - Intergenic
1042003281 8:64151115-64151137 CTTCTCAGAAGTTCTAACATAGG + Intergenic
1042396515 8:68297152-68297174 GATCTCTGAAGTTGTTGCATAGG + Intergenic
1044277883 8:90323206-90323228 CTTATCAGAAGGTGCCACATAGG + Intergenic
1047597961 8:126397433-126397455 CTACATTGAATGTGTTACATAGG - Intergenic
1047602468 8:126439788-126439810 CCTCACTGAAGGTGTTAACTAGG + Intergenic
1048394415 8:134000369-134000391 CATCTCTGAATGTGTGACCTTGG + Intergenic
1055162802 9:73151863-73151885 CTTCTCTGAAGATTTCACACTGG - Intronic
1057184679 9:93050454-93050476 CATCCCTGAGGGTGGTACATGGG - Intergenic
1059507224 9:114810559-114810581 CTTCTCTTCATGTGTTAAATGGG + Intergenic
1062678705 9:137764116-137764138 CTTCTCCGTAGGTGTTAAACAGG + Intronic
1186996435 X:15128551-15128573 CTTCTCTACAGGTGTTTCCTTGG + Intergenic
1188175049 X:26978716-26978738 TTTCTCAGAAGGTGTAACAAAGG + Intergenic
1188366620 X:29323651-29323673 CTTCTCTGGAGTGGTTCCATAGG + Intronic
1191709985 X:64139476-64139498 CCTCTCTGAAGATATGACATTGG - Intergenic
1193833492 X:86315546-86315568 CTTTCCTGAAGGTGTTCAATGGG - Intronic
1196419935 X:115510881-115510903 CCTCTCTAAAGGTGATAAATTGG - Intergenic
1197075117 X:122343981-122344003 CTTCTCTAAAAGTGATAAATTGG + Intergenic
1200710197 Y:6476351-6476373 CTTCTCTAAAGGTGCTATTTTGG - Intergenic
1201023918 Y:9688357-9688379 CTTCTCTAAAGGTGCTATTTTGG + Intergenic