ID: 1064311957

View in Genome Browser
Species Human (GRCh38)
Location 10:14219686-14219708
Sequence CCTTCTCTGAAGGTGTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064311957_1064311968 17 Left 1064311957 10:14219686-14219708 CCATGTAACACCTTCAGAGAAGG No data
Right 1064311968 10:14219726-14219748 AGTGCCCAGGGCAAGCTGGGAGG No data
1064311957_1064311966 13 Left 1064311957 10:14219686-14219708 CCATGTAACACCTTCAGAGAAGG No data
Right 1064311966 10:14219722-14219744 CAGAAGTGCCCAGGGCAAGCTGG No data
1064311957_1064311967 14 Left 1064311957 10:14219686-14219708 CCATGTAACACCTTCAGAGAAGG No data
Right 1064311967 10:14219723-14219745 AGAAGTGCCCAGGGCAAGCTGGG No data
1064311957_1064311964 4 Left 1064311957 10:14219686-14219708 CCATGTAACACCTTCAGAGAAGG No data
Right 1064311964 10:14219713-14219735 GGGGAACTTCAGAAGTGCCCAGG No data
1064311957_1064311965 5 Left 1064311957 10:14219686-14219708 CCATGTAACACCTTCAGAGAAGG No data
Right 1064311965 10:14219714-14219736 GGGAACTTCAGAAGTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064311957 Original CRISPR CCTTCTCTGAAGGTGTTACA TGG (reversed) Intronic
No off target data available for this crispr