ID: 1064311963

View in Genome Browser
Species Human (GRCh38)
Location 10:14219696-14219718
Sequence TTCCCCAGTCCCTTCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 1, 2: 5, 3: 27, 4: 302}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064311963_1064311964 -6 Left 1064311963 10:14219696-14219718 CCTTCAGAGAAGGGACTGGGGAA 0: 1
1: 1
2: 5
3: 27
4: 302
Right 1064311964 10:14219713-14219735 GGGGAACTTCAGAAGTGCCCAGG No data
1064311963_1064311968 7 Left 1064311963 10:14219696-14219718 CCTTCAGAGAAGGGACTGGGGAA 0: 1
1: 1
2: 5
3: 27
4: 302
Right 1064311968 10:14219726-14219748 AGTGCCCAGGGCAAGCTGGGAGG No data
1064311963_1064311967 4 Left 1064311963 10:14219696-14219718 CCTTCAGAGAAGGGACTGGGGAA 0: 1
1: 1
2: 5
3: 27
4: 302
Right 1064311967 10:14219723-14219745 AGAAGTGCCCAGGGCAAGCTGGG No data
1064311963_1064311966 3 Left 1064311963 10:14219696-14219718 CCTTCAGAGAAGGGACTGGGGAA 0: 1
1: 1
2: 5
3: 27
4: 302
Right 1064311966 10:14219722-14219744 CAGAAGTGCCCAGGGCAAGCTGG No data
1064311963_1064311965 -5 Left 1064311963 10:14219696-14219718 CCTTCAGAGAAGGGACTGGGGAA 0: 1
1: 1
2: 5
3: 27
4: 302
Right 1064311965 10:14219714-14219736 GGGAACTTCAGAAGTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064311963 Original CRISPR TTCCCCAGTCCCTTCTCTGA AGG (reversed) Intronic
900933062 1:5748617-5748639 TTGCCCAGGCCCCTCTCTGCAGG - Intergenic
900979620 1:6039033-6039055 TGCCCCAGTTCCCTCTCTGGGGG - Intronic
903365800 1:22804908-22804930 CTCCCCATTTCCTTCTCTAAGGG + Intronic
903381047 1:22897068-22897090 TTCCCCAGTGACTCCTCTGGTGG + Intronic
903681935 1:25103132-25103154 TTCCTCTGTCCCTTCCCTGAGGG - Intergenic
903974340 1:27139249-27139271 TTCACCAGACCCTTCTAAGAGGG - Intronic
904622418 1:31783278-31783300 TTCCCCAGTCCCTGGTCAGGAGG + Intergenic
905237433 1:36559887-36559909 GTCCCCAGCCTCTTCTGTGATGG + Intergenic
905398052 1:37680158-37680180 TTCCCAATTCCCTTCCCTGAAGG - Intergenic
905665112 1:39758914-39758936 TTCCCCAGGCCCCTCCCTGGGGG + Exonic
906728381 1:48060505-48060527 TTCCCCAGGACTTTCTTTGAGGG + Intergenic
907667942 1:56449806-56449828 TTCACCTCTCCCTTCTCTGAGGG + Intergenic
907844136 1:58188426-58188448 ATACCCAGTCACTTCTCTTAGGG - Intronic
908263101 1:62353834-62353856 TTCCTGAGTCCCCTCTCTTAAGG - Intergenic
908888334 1:68815530-68815552 GTCCCCAGTATCTTCTTTGAAGG + Intergenic
908897704 1:68919013-68919035 TTGCCAAATCTCTTCTCTGAAGG + Intergenic
911242315 1:95479669-95479691 TTCCCCAGTACCCTCTCACAGGG + Intergenic
912374609 1:109200007-109200029 TCTCCCATTCCCTTCTCTCATGG - Intronic
912490094 1:110058038-110058060 TTCCCCTTTCCCTTCCCAGAAGG + Intronic
913287068 1:117236371-117236393 TTCCCCAGACACTGCTCTGTTGG - Intergenic
913294786 1:117308862-117308884 TTCCCCAGTCTAACCTCTGATGG - Intergenic
913571789 1:120127725-120127747 TTTCCCAGTTTCTTCTCTGGAGG - Intergenic
913602676 1:120437150-120437172 GTACCCAGTACCTGCTCTGAGGG + Intergenic
913603424 1:120443503-120443525 GTACCCAGTACCTGCTCTGAGGG + Intergenic
914212236 1:145590411-145590433 GTACCCAGTACCTGCTCTGAGGG - Intergenic
914292708 1:146289346-146289368 TTTCCCAGTTTCTTCTCTGGAGG - Intergenic
914363848 1:146960771-146960793 GTACCCAGTACCTGCTCTGAGGG + Intronic
914487827 1:148126371-148126393 GTACCCAGTACCTGCTCTGAGGG - Intronic
914553752 1:148740129-148740151 TTTCCCAGTTTCTTCTCTGGAGG - Intergenic
916016255 1:160752373-160752395 TTCCCCATTCCCTTTGCTTAGGG + Intronic
916869119 1:168893367-168893389 TTCCCTAGTCCCTTCTCTGCTGG + Intergenic
917861591 1:179150266-179150288 TGCCACAGTCAGTTCTCTGATGG + Intronic
918038996 1:180900706-180900728 TTCACCTGTCCCTTCTTTGTTGG - Intergenic
918182015 1:182092193-182092215 TTTCCCAGTCCCATTTATGATGG - Intergenic
920664599 1:207953338-207953360 TTCCCCATTGCCTTCTCTAAGGG + Intergenic
921183160 1:212647082-212647104 TCTCCCACACCCTTCTCTGATGG - Intergenic
921185893 1:212669327-212669349 TTACCAAGTCCTGTCTCTGAGGG - Intergenic
921609295 1:217191757-217191779 AGCCCCAGTCACTTCTTTGAGGG + Intergenic
921677731 1:217994875-217994897 TTCCCAAGTCCTTTCACTGAGGG + Intergenic
922772479 1:228194117-228194139 TTTCCCATTCCTTTCTCTGATGG + Intergenic
924579789 1:245313894-245313916 CTCCCCAGTCTCTTCTTTCATGG + Intronic
1063025828 10:2178230-2178252 TTCCCCAGTCAGTTCTCTCTAGG + Intergenic
1063438974 10:6056765-6056787 TTCCCCTTTCTCTTCTCTCAGGG + Intronic
1063867491 10:10381535-10381557 TTCTCCATTCCCTTCCCTCAGGG + Intergenic
1064311963 10:14219696-14219718 TTCCCCAGTCCCTTCTCTGAAGG - Intronic
1064614276 10:17136270-17136292 TTCCCCACTCCCATCTTAGATGG - Intergenic
1067077131 10:43194406-43194428 TTGCCCAGTCCCTCCTGGGAAGG + Intergenic
1067093170 10:43281737-43281759 GGCTCCAGTCCCTTCTCAGAGGG + Intergenic
1067295943 10:44975267-44975289 TTGCCCCGTCCCCTCTCCGAAGG + Intronic
1068844751 10:61659225-61659247 TCTCCCAGTCCCCTCTCTGCAGG - Intergenic
1070347381 10:75558083-75558105 TTTCCCAATCCTTTCTCTGGAGG - Intronic
1072349045 10:94540074-94540096 ATCCCCAGTGCCTTATCTGGAGG + Intronic
1074991789 10:118715290-118715312 TTTCCCCTTCCCTTCTGTGAAGG - Intronic
1077305593 11:1867449-1867471 TTCCCCAGTCCCAGCCCTGCAGG + Intronic
1077440544 11:2566828-2566850 AGCCCCAGGGCCTTCTCTGAGGG - Intronic
1078143796 11:8709621-8709643 CTCCCCAGTCCATCCTCTGGGGG + Intronic
1079015071 11:16861908-16861930 TTCCCCAAACCCTTAGCTGATGG - Intronic
1079590253 11:22174875-22174897 TTCAACATTCCCTTCCCTGAAGG + Intergenic
1080244066 11:30159661-30159683 TGCCCCAGTCAGTTCTCAGAAGG + Intergenic
1080551964 11:33380150-33380172 TTCCCCAGGCCCTCCTCTGCCGG + Intergenic
1080673951 11:34407229-34407251 TACCCCAGCCTCCTCTCTGAAGG + Intergenic
1080945245 11:36965550-36965572 TTCCTCTGTCCCTTATCTGCAGG + Intergenic
1081277937 11:41173324-41173346 TTTCCCAATCCCTTCTCTGTAGG + Intronic
1081387454 11:42488539-42488561 TTCCCCAGTCCCATTTAGGAAGG + Intergenic
1081845843 11:46239541-46239563 TTCCCCAGTCCCTGCACAGCGGG + Intergenic
1083146256 11:60761421-60761443 ATCCCCAGTCCCTACTCAGACGG - Intronic
1084192079 11:67503967-67503989 TTCCCCATTCCCACATCTGAAGG + Intronic
1084491507 11:69481123-69481145 TGCCCCAGTGGCTGCTCTGACGG - Intergenic
1084630058 11:70342091-70342113 TTCCCCAGTCCCTGCCCGGGCGG - Intronic
1085320361 11:75570411-75570433 TTCCCCAGCCCCTTCTCCAGTGG + Intronic
1085452397 11:76642555-76642577 ACCCCCAGTCCCCTCTCTGAAGG + Intergenic
1085822410 11:79806792-79806814 TACCCCAGTAACTTCTCTCATGG + Intergenic
1086302919 11:85448712-85448734 GTCCCCAAACCCTTATCTGAAGG - Intronic
1086402810 11:86474294-86474316 TTCCTCAGTCACAGCTCTGACGG + Intronic
1087658419 11:100955512-100955534 TGCTCAAGTACCTTCTCTGATGG - Intronic
1088177502 11:107070522-107070544 TTCCCCTTTCCCTTGTCTGTAGG - Intergenic
1088526599 11:110762717-110762739 TTCCCCAGGCACTTTTTTGAGGG - Intergenic
1090319900 11:125833185-125833207 TTCCCCACTCCCTTCTCTTAAGG - Intergenic
1090575681 11:128100494-128100516 TGCCTCAGTCCTTTCTCTGTTGG + Intergenic
1090732957 11:129587674-129587696 TTCCCCAGCCCCCTCTCTCCTGG + Intergenic
1092487221 12:8913512-8913534 TCCCCCAGACCCTTCTGTAAAGG + Intergenic
1094551874 12:31460247-31460269 TGCTCCTGTCCCTTATCTGATGG - Exonic
1096295691 12:50382003-50382025 TTCCCCACTCCCTACTCAAAAGG - Intronic
1097081443 12:56434186-56434208 TTCTCCACTTCCTTCTCTGTTGG - Exonic
1098378310 12:69841285-69841307 TTCCCCAGTCCCTGTCTTGATGG - Intronic
1099966603 12:89453435-89453457 TTCTCCTGTCCCTGCTCTAAGGG - Intronic
1100201057 12:92298286-92298308 TTCCCCACTGCATTCTCAGAGGG + Intergenic
1100242501 12:92723792-92723814 TTCCCCAACCCCTTCTTGGATGG - Intronic
1101507258 12:105358975-105358997 TTCCCCTTTCACTTCTCTAATGG + Intronic
1101630335 12:106486778-106486800 ATCCCCACTCCCTTCTTTAACGG + Intronic
1102006506 12:109592418-109592440 CTCTCCTGTCCCTTCACTGACGG - Intronic
1103251034 12:119500232-119500254 TTTGCCAGTCTTTTCTCTGATGG + Intronic
1104502156 12:129296776-129296798 TTCCCCAATCCCTGCTCTGGGGG - Intronic
1104678263 12:130730263-130730285 TTCCCGGGTTCCTTCTCTGCAGG - Intergenic
1104791159 12:131482976-131482998 TTTGCCAGTGCCTTCTCTGCTGG + Intergenic
1106077972 13:26476936-26476958 TTCCCAAGGGGCTTCTCTGAGGG - Intergenic
1108211551 13:48144666-48144688 ATCCCCAGTCCCATATCTGCTGG + Intergenic
1109598541 13:64591790-64591812 ATCCTCAGTCTTTTCTCTGAAGG + Intergenic
1111234546 13:85391508-85391530 TTCCTCTTTCCCTTCTCAGAGGG - Intergenic
1111869170 13:93808948-93808970 GTCCACAGGCACTTCTCTGATGG - Intronic
1112655278 13:101445852-101445874 TACCCCTATCTCTTCTCTGAGGG - Intergenic
1112968945 13:105235052-105235074 TGCCCCTGTCTCTTCTCTCAGGG - Intergenic
1114902802 14:27085908-27085930 TTCCACAGTCACTTCTCTCAAGG - Intergenic
1115270982 14:31552220-31552242 TCCCCCAGGCGCTTCTCTTATGG + Intronic
1117353193 14:54901189-54901211 TGCCCCAGTTATTTCTCTGAAGG - Intronic
1118157575 14:63256568-63256590 TTGGCCAGTCCCTTCTTGGAGGG + Intronic
1118984595 14:70742609-70742631 CACCCCAGTCTTTTCTCTGATGG - Intronic
1119666503 14:76488818-76488840 TTCCCCAGTGCGTGCTCTCAGGG + Intronic
1120504105 14:85333252-85333274 TTCCCGGGTCCCATTTCTGAAGG - Intergenic
1120572710 14:86141843-86141865 CACCCGAGTCCCTCCTCTGACGG + Intergenic
1120750570 14:88193915-88193937 GTCCTCTGTCCCTTCTGTGAAGG + Intronic
1121469933 14:94144822-94144844 TTTTCCAGTGCCTTCTCTGTGGG - Intergenic
1121870812 14:97405069-97405091 GTCCTCTCTCCCTTCTCTGAAGG + Intergenic
1122070447 14:99202443-99202465 CTACCCAGCACCTTCTCTGATGG - Intronic
1122778769 14:104134920-104134942 TTCCCCAGTCCCCTTCCTGTGGG + Intergenic
1124529423 15:30491378-30491400 TACCCCAGTCCTGTCTTTGAAGG - Intergenic
1126110600 15:45172629-45172651 TCCCCCAGTCCATCCTCTCAGGG + Intronic
1126915933 15:53466392-53466414 TTCCCCAGTCCATCCTCTGAAGG - Intergenic
1128181937 15:65611994-65612016 TTCCCCTATCCCCTCTTTGAGGG + Intronic
1129239809 15:74244591-74244613 TTCTCCAGTCACTTCTATTATGG + Intronic
1129959822 15:79674100-79674122 TTCCACAGCCCATTCTCTTAAGG - Intergenic
1131314213 15:91318544-91318566 TTTCCCAGTCTCTTCCCTGAAGG + Intergenic
1132017638 15:98333041-98333063 TTCCCCAGTTCCTTTTCAGAGGG - Intergenic
1132554457 16:566425-566447 TTCCCAAGTCCCGAGTCTGAGGG + Intergenic
1134260825 16:12649613-12649635 TTCCCTAGTTTCTTCTATGATGG + Intergenic
1134391663 16:13825542-13825564 TTCCCCAGTAGCTTTTCTGCTGG + Intergenic
1136058681 16:27709750-27709772 TTTCCCAGCCCCTGCTCTGTGGG + Intronic
1138356753 16:56387439-56387461 CCCCCTAGTCCCTTCTTTGAGGG + Intronic
1138835178 16:60426048-60426070 TTCCTTAGTCCCTTCCCTGATGG + Intergenic
1141176953 16:81727082-81727104 TGCCCCAGGCACATCTCTGATGG - Intergenic
1141867259 16:86759063-86759085 TTCCCGGCTCCCTTCTCTGTCGG - Intergenic
1142245732 16:88969331-88969353 TTCTCCAGTTCCTTCTCTACTGG + Intronic
1142299729 16:89249340-89249362 TTCCACTCTGCCTTCTCTGAGGG + Intergenic
1143762434 17:9115148-9115170 TTACACAGTCCTTTCTCTCAAGG - Intronic
1144188731 17:12823392-12823414 TTCTCCAGTCCTTTCTCTTATGG + Intronic
1144330653 17:14221058-14221080 TTCTCCATTTCCTTTTCTGAAGG + Intergenic
1144590772 17:16521702-16521724 TTCCAAAGTCCCACCTCTGATGG - Intergenic
1147183679 17:38702464-38702486 TGCCCCAGTCCCTTCGCCGCGGG + Intergenic
1147506363 17:41021428-41021450 TCCCCAAGTCCCATCTATGAAGG - Intergenic
1147506631 17:41024538-41024560 TCCCCAAGTCCCATCTATGAAGG + Intergenic
1148378128 17:47168890-47168912 GTCCCCAGTCACTTCTCCCACGG + Intronic
1151297360 17:73195242-73195264 TCCCCCAATTCCTGCTCTGAAGG + Intronic
1151494733 17:74452637-74452659 CTCCCCACCTCCTTCTCTGAGGG - Intergenic
1151617525 17:75223987-75224009 TTCTCCAGTCCCTCCTCTTGGGG + Intronic
1151654397 17:75489078-75489100 TCTCCCAGTCTCTACTCTGAGGG + Intronic
1151678422 17:75611693-75611715 TTCTCCAGTCCCTTTACTGTGGG + Intergenic
1152356906 17:79811928-79811950 CTCCCCAGTCCCTAGTCTGGAGG - Intergenic
1152742491 17:82024457-82024479 GTCCCCAGGCCGCTCTCTGATGG + Intronic
1153870850 18:9318748-9318770 TTTCCCAGTCACTTGTCAGATGG + Intergenic
1155107734 18:22684250-22684272 TTCCCCAGTCAGTTCTCCAAAGG + Intergenic
1155135325 18:22985995-22986017 CCCCCCAGTCCCTTCCCTGCTGG + Intronic
1156469997 18:37371462-37371484 TTGCCCAGCGCCTTCTCTGCAGG + Intronic
1157950783 18:52034561-52034583 TTCCCCTGTCACATCTCTGCAGG + Intergenic
1159154083 18:64559493-64559515 TCCTCCAGTCCCTTCACTGATGG + Intergenic
1159994943 18:74955327-74955349 TTCCCAGGTCCCTTCTCTACTGG - Intronic
1160243380 18:77138223-77138245 TTCCCTAGTGCTTTCTCTGCTGG - Intergenic
1160447248 18:78937241-78937263 TTCCAAACTCCCTTCTCTCAAGG + Intergenic
1160672316 19:371627-371649 TTCTCCATTCCCTTCTGGGACGG + Intronic
1160692879 19:467873-467895 CACCCCAGTCCCATCTCGGAGGG + Intronic
1161553779 19:4929022-4929044 CACCCCAGTCCCTTCCCTCAGGG - Intronic
1163130780 19:15271546-15271568 GTCCCCAGTTCCTTCTCTCCTGG + Intronic
1163642703 19:18470493-18470515 TTCCCCAGGACATTCTCTCAGGG - Intronic
1163667985 19:18612018-18612040 GTCCCCACTCCCTTATCTGGCGG + Intronic
1164725198 19:30461441-30461463 TTCCCTGCTCCTTTCTCTGAAGG - Intronic
1165741581 19:38207963-38207985 TCCCCCATCCCCTTCTCTGGGGG + Exonic
1165996655 19:39848594-39848616 CTCCCCAGTCCCATTTCTGCCGG - Intergenic
1166214327 19:41325650-41325672 TTCCCCATCCCTTTCTCTGCTGG + Intronic
1166822740 19:45590717-45590739 TCCCACAGTCCCTTCTCTCCTGG - Exonic
1168708396 19:58482669-58482691 TTCCCCATCCCCTTTTATGAGGG + Intronic
925004833 2:433830-433852 TTCTGCAGTCCCTCCTTTGAGGG - Intergenic
925458699 2:4041902-4041924 CTTCCCAGTCCCTTCTCGGGTGG - Intergenic
928412416 2:31065334-31065356 TGTCCCAGTCCCTCCACTGATGG + Intronic
928431674 2:31224109-31224131 TGCCCCAGTCTCTTCTCAAAAGG - Intronic
929588256 2:43129608-43129630 CTCCCCTTTCCCTTCTCTGCAGG + Intergenic
930345797 2:50179502-50179524 TTTCCCCATCCCTTCTCTAAAGG + Intronic
931771799 2:65503783-65503805 TTTCCCCTTCCCTTCTCTGTGGG + Intergenic
931928131 2:67097651-67097673 CTCCCCAGGCCTTGCTCTGAAGG - Intergenic
932715843 2:74100385-74100407 TTCCCCAGGCCTGTCTCTGAAGG + Exonic
932735330 2:74250449-74250471 TTCCCAAGTGACTTCTATGATGG - Exonic
932828081 2:74959406-74959428 TACCCAAGTCTCTCCTCTGAAGG - Exonic
935881027 2:107565833-107565855 TTCCCCAGTTCCTCCTCCCAGGG - Intergenic
937057549 2:118952287-118952309 TTCTCCCTTCCCCTCTCTGAAGG + Intronic
937626796 2:124053004-124053026 CTCCCCCGTCCCTGCTCTGTGGG + Intronic
939177104 2:138761233-138761255 TTCACCAGCGCATTCTCTGAAGG + Intronic
939538608 2:143463947-143463969 CTCCCCAGTTCATTCTGTGATGG + Intronic
940451127 2:153838489-153838511 TTTCCCAGCCCCTTCATTGAAGG + Intergenic
940616461 2:156054726-156054748 TTCCCCAGTCCCATGTATGGTGG + Intergenic
940755976 2:157683921-157683943 TTCCCCAATCCTTTTTCTGTTGG - Intergenic
946118127 2:217482023-217482045 TACCCCAATCCATTTTCTGATGG - Intronic
946767318 2:223052800-223052822 TTCCCCAGCCCCTGCTGTGGAGG + Exonic
947113609 2:226746338-226746360 TTCCCCAATCTCTCATCTGAAGG + Intronic
947745422 2:232504797-232504819 CTCCCCTGTCCCTTCCATGAAGG + Intergenic
948291855 2:236831518-236831540 TCTCCCAGTCCCTTCCCTGATGG - Intergenic
948699201 2:239749853-239749875 CTCCCTAGTCCCTGCTCAGAAGG - Intergenic
1168892878 20:1306111-1306133 TTCCCCCCTCCCTTCTCCCATGG + Exonic
1169413068 20:5391281-5391303 CTCCCAAGTCCCTTCTCCCAAGG + Intergenic
1169752873 20:9012723-9012745 TTCCACAGTCCCTATTCTTATGG - Intergenic
1170107820 20:12770863-12770885 CTTACCAGTCCCTTCTCTAATGG + Intergenic
1172177695 20:32982591-32982613 TGACCCAGGCCCATCTCTGATGG - Intergenic
1172177728 20:32982725-32982747 TGGCCCAGGCCCATCTCTGATGG - Intergenic
1172309377 20:33905890-33905912 TTCCCAAGCCCATTCTCTGAAGG - Intergenic
1172529732 20:35621647-35621669 TTCACCAGTCCCTGCCCTCAAGG + Intergenic
1172620768 20:36316821-36316843 CTCCCCAGCCTCTTCTCTGGGGG + Intronic
1173168493 20:40703299-40703321 CTTCCCAGTCCCATCTCTGTGGG - Intergenic
1174082988 20:47983930-47983952 TTCCTAAGTCCCTTCACTGGGGG - Intergenic
1174132964 20:48359053-48359075 TTCCTAAGTCCCTTCACTGGGGG + Intergenic
1175844562 20:62051683-62051705 CCCCACAGTCCCTCCTCTGAGGG + Intronic
1175897804 20:62347081-62347103 GTGCTCAGTCCCTTCCCTGAAGG + Intronic
1176372335 21:6069600-6069622 TTCCCAAGTCCTTTCGCTCAGGG - Intergenic
1178430591 21:32515262-32515284 TTCACCTGTACCTTCTATGAAGG + Exonic
1179751183 21:43468939-43468961 TTCCCAAGTCCTTTCGCTCAGGG + Intergenic
1179932308 21:44578912-44578934 TGCCCCAGGCCCTCCTCTGGGGG - Intronic
1180100618 21:45582324-45582346 TTACCAGGTACCTTCTCTGAGGG - Intergenic
1181558089 22:23683644-23683666 ATCCCCAGTCCCTTCTCTGATGG - Intergenic
1182189450 22:28443239-28443261 GTTCTCAGTCTCTTCTCTGAGGG - Intronic
1182278848 22:29206575-29206597 CACCCCAGTCCCTCCTCCGAGGG - Intronic
1183354184 22:37349621-37349643 CCACCCAGTGCCTTCTCTGAAGG - Intergenic
1184090173 22:42288982-42289004 TTCCCCAGTGTCTTCACTTAAGG - Intronic
1184206546 22:43007607-43007629 CTCCCAAGTCACTTCCCTGAAGG + Intronic
953224196 3:41001544-41001566 GGCCCCAGTCCCTTCTCTTGTGG - Intergenic
954796233 3:53162338-53162360 TTCCCCAGTTCCCTCTCTCTTGG + Intronic
957578747 3:82043421-82043443 TTCTACATTCCCTTCTCTCAGGG + Intergenic
958705537 3:97649485-97649507 TTTCCCAGTGAATTCTCTGAAGG - Intronic
960441512 3:117694370-117694392 TTCTCCATTCCCTTATCTAAGGG + Intergenic
961020669 3:123503609-123503631 TCCCCCAGTCCCTTCCCAGCTGG + Intronic
963240123 3:142994824-142994846 TTCCCAAGTCAGTTCTCTGGTGG + Intronic
965460302 3:168953870-168953892 TGCCCCCTTCCCTTCTCCGATGG + Intergenic
966687941 3:182716212-182716234 TTCCCCAGCTCCTTCTGTGTGGG + Intergenic
967027058 3:185573973-185573995 GTCTCCAGTCCCTACTCGGATGG - Intergenic
967972638 3:195010823-195010845 TTCCTCGGTTCCTTCTTTGAGGG - Intergenic
969747676 4:9086921-9086943 CTTCCCACTCCCTTATCTGAAGG + Intergenic
970289010 4:14551440-14551462 TTCACATGTCCCTTCTATGATGG - Intergenic
970333559 4:15007334-15007356 TGCCCCAGCCACTGCTCTGATGG - Exonic
970986946 4:22170128-22170150 TTCACCAGTGCCTTCTCTAGTGG - Intergenic
972456831 4:39263409-39263431 TTCTCCACTTCCTTCTCAGATGG + Intronic
973152252 4:46902482-46902504 TTGCTGATTCCCTTCTCTGAAGG - Intronic
975425260 4:74217951-74217973 TGCCCCATGCCCTTCTCAGATGG + Intronic
976049925 4:80999372-80999394 TTCTCCAGGCCCTATTCTGAGGG - Intergenic
976380654 4:84394753-84394775 TTCCCCAGTGCCTGCCCTGGGGG - Intergenic
978292457 4:107159395-107159417 TTGCACATTCACTTCTCTGATGG - Intronic
979608409 4:122664340-122664362 TCACCCACTCCTTTCTCTGATGG - Intergenic
980340285 4:131535463-131535485 TTCACCAGTTTCTTCTCAGAAGG + Intergenic
982780124 4:159481944-159481966 TTCCCCAGTCCAAAATCTGAAGG + Intergenic
984188537 4:176576576-176576598 TTCCACACTCCCTTCCCTGTTGG - Intergenic
984922310 4:184776451-184776473 TGCCTCCTTCCCTTCTCTGAAGG - Intronic
985610318 5:884397-884419 TTTTCCAGTCACTTTTCTGATGG - Intronic
985622736 5:963953-963975 CTCCCCAGTGCCTGGTCTGACGG + Intergenic
986616168 5:9619508-9619530 TTGCACAGTCCCTGCCCTGAGGG - Intergenic
989143595 5:38226356-38226378 TTTCCCAGACTCTTCACTGATGG + Intergenic
989350051 5:40475794-40475816 TTCACCATTGCTTTCTCTGAGGG - Intergenic
989475620 5:41870060-41870082 TTCTGCAGTCGCTTCCCTGATGG - Intronic
991438379 5:66619285-66619307 TCACCAAGTCCCTACTCTGAGGG - Intronic
995275610 5:110274444-110274466 TATCCCACTCACTTCTCTGATGG + Intergenic
996327489 5:122291895-122291917 GTCCTCTGTCCCTTCACTGATGG + Intergenic
996787617 5:127257196-127257218 ACTCCCAGTCCCTTCTCTGTGGG + Intergenic
997421870 5:133775931-133775953 TTCCCCACTACCTTATATGAAGG + Intergenic
997599094 5:135127290-135127312 TCCCCCAGGCCCTTCCCTGCAGG - Intronic
999385486 5:151151180-151151202 TTCCACAGCCCCGCCTCTGAGGG + Intronic
1001282422 5:170396299-170396321 TTCCCCAGTTCCTTCCCTGAGGG - Intronic
1001689730 5:173624114-173624136 TACCCCAGACCTATCTCTGAAGG - Intergenic
1002355608 5:178626741-178626763 TGCCGCTGACCCTTCTCTGAGGG - Intronic
1003060318 6:2857725-2857747 GTCCCCACACCCCTCTCTGAGGG + Intergenic
1003331019 6:5128871-5128893 AGCCCCAGGCCCTTCTCTGCTGG - Intronic
1003994452 6:11524765-11524787 TTCCAGAGTGTCTTCTCTGAAGG - Intergenic
1005516712 6:26561717-26561739 TTCCCCAATCCAGTGTCTGAGGG - Intergenic
1005897547 6:30190975-30190997 CTCCTTAGTCCCTTCTCTGTGGG - Intronic
1006860451 6:37169132-37169154 TGCCTCAGCCCCTTCTGTGAGGG - Intergenic
1007772687 6:44203799-44203821 CTCTCAAGTCCCTTCTCTCAAGG + Intergenic
1008090482 6:47289028-47289050 TCCCCCAGTCTCTTCTCAGAAGG - Intronic
1008193586 6:48490904-48490926 TTCCCAAAGCCCTTCTCTTAAGG - Intergenic
1008620400 6:53265820-53265842 TTATCCACTCACTTCTCTGACGG + Intergenic
1008644054 6:53495391-53495413 TTTCCCATTCCCTTCTGTTATGG + Intergenic
1011266661 6:85527818-85527840 TTCCTCAGTCCCTTTTCTTTTGG - Intronic
1012060281 6:94469653-94469675 ATCCCCAGTGCATTCTGTGATGG + Intergenic
1013618956 6:111871352-111871374 TTCCCCAGTCCCTGCTCCATGGG - Intronic
1013996609 6:116316024-116316046 TTCCCCATTACATACTCTGAAGG + Intronic
1015158680 6:130126764-130126786 TTCCCCTCTGCCTTCTCTGAAGG + Intronic
1016904538 6:149135930-149135952 TTCCTCAATCCCTTCACTTAGGG - Intergenic
1017898567 6:158701888-158701910 TACCCCAGTCTCTGCCCTGATGG + Intronic
1018629006 6:165805981-165806003 TTCCTCAGTCCCTGCTTTGTAGG + Intronic
1019062327 6:169265438-169265460 TCCCCCAGTGCATTCCCTGAGGG + Intergenic
1019316951 7:391258-391280 TTCCCCAGCCACTTCCCTCAGGG - Intergenic
1019622146 7:1997807-1997829 CTCCCCAGGACCTCCTCTGAAGG + Intronic
1019686372 7:2384282-2384304 ATCCCCACTCCCTATTCTGAGGG - Intergenic
1021808873 7:24383249-24383271 TTCCCCAGTCCCTTCTGGATGGG - Intergenic
1023882187 7:44326692-44326714 ATCCCCACACTCTTCTCTGACGG + Intronic
1028793470 7:94878743-94878765 CTCCCCATTCCCCACTCTGAAGG - Intergenic
1029137310 7:98382753-98382775 TTCCACAATCCCTCATCTGATGG - Intronic
1031117482 7:117683653-117683675 TTACCAAGTCGCTTCTGTGATGG + Intronic
1031866411 7:127042219-127042241 TTCCCCTGTCTCTGCTCTGGAGG - Intronic
1032503060 7:132414449-132414471 TACCGCAGTCTCTCCTCTGATGG - Intronic
1032529482 7:132608610-132608632 TTGCCCAGTCTCTCCTCTCATGG + Intronic
1034436333 7:151064418-151064440 GACCCCAGTCCCTTCTTTGCTGG - Intronic
1034531678 7:151699802-151699824 CTCCCCACTGCCTCCTCTGAGGG - Intronic
1035610778 8:962605-962627 TTTCCCACTCCCCTCTCGGAGGG - Intergenic
1037048088 8:14334986-14335008 TTCCTCAGTCCCAGCTCAGAAGG - Intronic
1039019032 8:33185140-33185162 TTCCCCAATTCCCTGTCTGATGG + Intergenic
1039468056 8:37797558-37797580 GTCCCCAGTCCCGGCTCGGACGG - Intronic
1042942044 8:74117692-74117714 TTCTCCAGTCCCTTCTCTCCCGG - Intergenic
1042959562 8:74289028-74289050 TTCCCCACTCCCTTCACAGATGG - Intronic
1045486248 8:102633849-102633871 TTCCCGAGTCACTGCTCGGAGGG + Intergenic
1045685138 8:104703754-104703776 TTTCCCAGTCTCATCTTTGAAGG - Intronic
1046089494 8:109483066-109483088 TTCCAAAGTCCTGTCTCTGATGG + Exonic
1046611146 8:116426835-116426857 TTACCCAGTCCTTGTTCTGATGG - Intergenic
1047545282 8:125810732-125810754 TTCCCTGGTCTCTTCTCTGTGGG - Intergenic
1048384633 8:133900765-133900787 TTTGTCACTCCCTTCTCTGACGG + Intergenic
1048706563 8:137160243-137160265 TTCCCCAGTCTCATGCCTGAAGG + Intergenic
1049361976 8:142216212-142216234 TGCCCCCGCCCCTCCTCTGAGGG + Intronic
1049495060 8:142926162-142926184 TTCTTCAGTCCATGCTCTGAAGG + Intergenic
1050435031 9:5599980-5600002 TCCCCCAGTGCCTTCCCTGCTGG - Intergenic
1050472813 9:6009704-6009726 GTCCACAGACTCTTCTCTGAGGG - Intergenic
1052016301 9:23472317-23472339 TTTCCCAGTATCTTCTCTCAAGG + Intergenic
1053047069 9:34928643-34928665 TTCCCCTCTCCCTTCTCCTATGG + Intergenic
1056724306 9:89099551-89099573 TTCCCCAATCCCTTCTGGAAAGG - Intronic
1056781323 9:89553344-89553366 TTCCTCATTCCCTATTCTGAGGG + Intergenic
1056998987 9:91490145-91490167 AGCCCCAGTCCCTTCCCTGTAGG + Intergenic
1057361430 9:94376917-94376939 TTCCCCAGTTCTTTCTCCGTTGG + Intronic
1057661931 9:97011253-97011275 TTCCCCAGTTCTTTCTCCGTTGG - Intronic
1060263972 9:122099393-122099415 TTCCCCACACCCTTCTCTCCTGG - Intergenic
1061145209 9:128793668-128793690 CTCCCAGGACCCTTCTCTGATGG - Intronic
1061241719 9:129378433-129378455 TTCCTCAGGCGCTTCTCTGAAGG - Intergenic
1185817218 X:3167334-3167356 TTCCCCAGCCCTTGCACTGATGG - Intergenic
1186077775 X:5899035-5899057 TTCCCCATTTCCTTCTTTTATGG + Intronic
1186900678 X:14052082-14052104 TTCTCCAGACCCTTCTCTGAAGG - Intergenic
1187206110 X:17183138-17183160 TTCCCTAGTAAGTTCTCTGAAGG - Intergenic
1189856607 X:45230231-45230253 TTCTTGAGTTCCTTCTCTGAAGG + Intergenic
1190053573 X:47169644-47169666 GTTCCCACTCCCCTCTCTGAGGG + Intronic
1190725835 X:53190106-53190128 CTCCCCAGCCCCTTATCTGAGGG + Intergenic
1192507954 X:71701454-71701476 ATCGCCAGTCCCTACTCGGACGG - Intergenic
1192518742 X:71780098-71780120 ATCGCCAGTCCCTACTCGGACGG + Intergenic
1193230029 X:79032758-79032780 TTCCCCACTTTCTTCTCTGAAGG + Intergenic
1193957992 X:87886303-87886325 CTCCCCAGTCCATTGTCTCAGGG + Intergenic
1197186527 X:123593380-123593402 TTACACAGTCCCTGCTCTCATGG + Intergenic
1197455405 X:126672128-126672150 GTCCCCAGTCTCTTCTTTTAGGG - Intergenic
1198074064 X:133177993-133178015 TTCCCCATTTCTTTATCTGATGG + Intergenic
1200022477 X:153223885-153223907 TTCTCCCTTCCCTTCTCTGCAGG + Intergenic