ID: 1064311964

View in Genome Browser
Species Human (GRCh38)
Location 10:14219713-14219735
Sequence GGGGAACTTCAGAAGTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064311956_1064311964 5 Left 1064311956 10:14219685-14219707 CCCATGTAACACCTTCAGAGAAG 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1064311964 10:14219713-14219735 GGGGAACTTCAGAAGTGCCCAGG No data
1064311957_1064311964 4 Left 1064311957 10:14219686-14219708 CCATGTAACACCTTCAGAGAAGG No data
Right 1064311964 10:14219713-14219735 GGGGAACTTCAGAAGTGCCCAGG No data
1064311963_1064311964 -6 Left 1064311963 10:14219696-14219718 CCTTCAGAGAAGGGACTGGGGAA 0: 1
1: 1
2: 5
3: 27
4: 302
Right 1064311964 10:14219713-14219735 GGGGAACTTCAGAAGTGCCCAGG No data
1064311955_1064311964 6 Left 1064311955 10:14219684-14219706 CCCCATGTAACACCTTCAGAGAA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1064311964 10:14219713-14219735 GGGGAACTTCAGAAGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064311964 Original CRISPR GGGGAACTTCAGAAGTGCCC AGG Intronic
No off target data available for this crispr