ID: 1064312196

View in Genome Browser
Species Human (GRCh38)
Location 10:14221361-14221383
Sequence TGTGGCCTAATTTCATAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064312194_1064312196 1 Left 1064312194 10:14221337-14221359 CCAAGGGGAGAGCATTGGTGGAG 0: 1
1: 0
2: 1
3: 60
4: 805
Right 1064312196 10:14221361-14221383 TGTGGCCTAATTTCATAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064312196 Original CRISPR TGTGGCCTAATTTCATAGCC TGG Intronic
No off target data available for this crispr