ID: 1064318006

View in Genome Browser
Species Human (GRCh38)
Location 10:14276212-14276234
Sequence GGCAGGCATGACAGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064318006_1064318015 16 Left 1064318006 10:14276212-14276234 CCTGCCTCACTGTCATGCCTGCC No data
Right 1064318015 10:14276251-14276273 ACTGGCCATGAAAGGGCACTGGG No data
1064318006_1064318010 -2 Left 1064318006 10:14276212-14276234 CCTGCCTCACTGTCATGCCTGCC No data
Right 1064318010 10:14276233-14276255 CCAGATGCTGCCTGTGACACTGG No data
1064318006_1064318012 8 Left 1064318006 10:14276212-14276234 CCTGCCTCACTGTCATGCCTGCC No data
Right 1064318012 10:14276243-14276265 CCTGTGACACTGGCCATGAAAGG No data
1064318006_1064318013 9 Left 1064318006 10:14276212-14276234 CCTGCCTCACTGTCATGCCTGCC No data
Right 1064318013 10:14276244-14276266 CTGTGACACTGGCCATGAAAGGG No data
1064318006_1064318014 15 Left 1064318006 10:14276212-14276234 CCTGCCTCACTGTCATGCCTGCC No data
Right 1064318014 10:14276250-14276272 CACTGGCCATGAAAGGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064318006 Original CRISPR GGCAGGCATGACAGTGAGGC AGG (reversed) Intronic