ID: 1064323595

View in Genome Browser
Species Human (GRCh38)
Location 10:14328807-14328829
Sequence TATCCTCCATCGTCTACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064323595_1064323598 20 Left 1064323595 10:14328807-14328829 CCACAGGTAGACGATGGAGGATA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1064323598 10:14328850-14328872 ATTAGTAAGGGAAAGAAGTCAGG No data
1064323595_1064323600 27 Left 1064323595 10:14328807-14328829 CCACAGGTAGACGATGGAGGATA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1064323600 10:14328857-14328879 AGGGAAAGAAGTCAGGTAATGGG No data
1064323595_1064323597 8 Left 1064323595 10:14328807-14328829 CCACAGGTAGACGATGGAGGATA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1064323597 10:14328838-14328860 TCAGACGATAGAATTAGTAAGGG No data
1064323595_1064323599 26 Left 1064323595 10:14328807-14328829 CCACAGGTAGACGATGGAGGATA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1064323599 10:14328856-14328878 AAGGGAAAGAAGTCAGGTAATGG No data
1064323595_1064323596 7 Left 1064323595 10:14328807-14328829 CCACAGGTAGACGATGGAGGATA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1064323596 10:14328837-14328859 ATCAGACGATAGAATTAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064323595 Original CRISPR TATCCTCCATCGTCTACCTG TGG (reversed) Intronic
905225428 1:36475621-36475643 CAGCCCCCATCGTCCACCTGGGG - Exonic
915197058 1:154197351-154197373 TATCCTCCATGTTCTCCCTCAGG - Intergenic
922345573 1:224693569-224693591 CATCCTCCAGCGACCACCTGAGG + Intronic
1064323595 10:14328807-14328829 TATCCTCCATCGTCTACCTGTGG - Intronic
1065783003 10:29187989-29188011 TATCCTCCTTCATCTACGTAAGG + Intergenic
1067961560 10:50857852-50857874 TATCTTCCATCCTCTCCATGAGG + Intronic
1075030552 10:119021891-119021913 GATCCTCCATCCGCTCCCTGGGG + Intergenic
1076152253 10:128172048-128172070 TTCCCTCCCTCCTCTACCTGTGG + Intergenic
1092447691 12:8572897-8572919 TATTCTCCAGAGTCTATCTGTGG + Intergenic
1095531024 12:43186576-43186598 TATCCTCCAGGGTCTACTTTAGG - Intergenic
1111116018 13:83779266-83779288 TATGCCCCAGCCTCTACCTGTGG - Intergenic
1119708696 14:76805198-76805220 TATCCCCCATCGTATAGATGAGG + Intronic
1126600014 15:50418794-50418816 TATTCCCCATCGACTCCCTGGGG + Intergenic
1127503565 15:59577294-59577316 TATCCTCCTGCCTCTACCTCTGG + Intergenic
1129468949 15:75739569-75739591 GATCCTCCAACGTCAGCCTGTGG + Intergenic
1132222795 15:100117414-100117436 TAACCTCCAGAGTATACCTGGGG - Intronic
1133221408 16:4320630-4320652 TTCCCTGCATCGTCTGCCTGGGG + Intronic
1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG + Exonic
1155240915 18:23862915-23862937 GACCCTCCATAGGCTACCTGAGG + Intronic
1160130457 18:76220806-76220828 TACCCTCCATCGCCTGCTTGGGG - Intergenic
1160269482 18:77371605-77371627 TTTACCCCATCGTGTACCTGAGG + Intergenic
1164754408 19:30679313-30679335 TCACCTCCATCATCTAGCTGCGG - Intronic
932713892 2:74087835-74087857 TCTCCTCCAGCGTGTGCCTGCGG - Exonic
933624026 2:84578140-84578162 TATCTTCTATCATCTACCAGGGG - Intronic
941492048 2:166154568-166154590 TATCCTTCATCGTTTATTTGGGG - Intergenic
946410839 2:219514466-219514488 TCTCCTCGATCGTCTCCTTGTGG - Exonic
946452063 2:219788737-219788759 TATCCTCCATACTCTTCTTGTGG + Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170753951 20:19180412-19180434 TATCTTTCATAGTCTGCCTGTGG - Intergenic
949306984 3:2652770-2652792 TATTCTCCATCGTAGACGTGTGG + Intronic
956092545 3:65683188-65683210 TATCCACCATTGTATACCAGGGG - Intronic
967625737 3:191681774-191681796 CCTCCTCCATCTTCTACATGTGG + Intergenic
972126419 4:35772281-35772303 TATCTTTCATCAACTACCTGTGG + Intergenic
976388700 4:84487440-84487462 TATCATCCCTAATCTACCTGTGG + Intergenic
981446828 4:144849761-144849783 AATCCACCATCATCTACTTGGGG - Intergenic
984300669 4:177912745-177912767 TATCCTCAAGCCTCGACCTGTGG - Intronic
990359495 5:55004139-55004161 GATGCTCCATCCTCTGCCTGGGG + Intronic
1002472027 5:179441003-179441025 TATCCTCCCACCTCAACCTGGGG - Intergenic
1002711384 5:181197262-181197284 TATCCTCAATCCTCTCCCTGTGG - Intronic
1005136513 6:22574844-22574866 GATGCTCCCTTGTCTACCTGGGG - Intergenic
1011064480 6:83310582-83310604 TGTGCTCCATCTTCTACCAGTGG - Intronic
1022777962 7:33546904-33546926 AATCCAACATCTTCTACCTGAGG - Intronic
1044114637 8:88320051-88320073 TATCCCCCAACCTCTACCAGAGG + Intronic
1047146019 8:122200209-122200231 TATCCACCACCATCTACCAGAGG + Intergenic
1048147840 8:131862793-131862815 TATCCTCCCTCCTCAACCTCCGG - Intergenic
1059578661 9:115519806-115519828 TATCCTCCCTAGTCTACCTCTGG + Intergenic
1186405843 X:9301589-9301611 TCTCCTCGAACGTCTTCCTGAGG - Intergenic
1188961148 X:36493124-36493146 TTTCCTCCTTCTTCTTCCTGAGG - Intergenic
1189906595 X:45766944-45766966 TATCCTCTGTAGTCTGCCTGGGG + Intergenic
1191957803 X:66665137-66665159 TGTCCTCCTTCCTTTACCTGAGG - Intergenic
1195760920 X:108245549-108245571 AATCCTCCATCGTCTCAGTGTGG - Intronic