ID: 1064323630

View in Genome Browser
Species Human (GRCh38)
Location 10:14329092-14329114
Sequence ATGAGTTTATGGAGGTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064323630 Original CRISPR ATGAGTTTATGGAGGTGACT TGG (reversed) Intronic
900194200 1:1366160-1366182 ATGAGTGGATGGATGTGAATGGG + Intergenic
902401707 1:16161425-16161447 ATGAGTTTACAGAGGTGAAGTGG - Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904857690 1:33511350-33511372 ATCAGGTTATTGAGGTGACAAGG + Intergenic
905784513 1:40743448-40743470 TTGTCTTTATGGAGGTGAGTTGG + Intronic
907959661 1:59266921-59266943 CTGAGTTTTTGGACATGACTTGG - Intergenic
909196578 1:72634120-72634142 ATCAATTTAGGGAGATGACTGGG + Intergenic
914662399 1:149802576-149802598 AGGAGTTTATGAAGGAGAATTGG + Intronic
916869992 1:168903342-168903364 AAAAGTATAAGGAGGTGACTGGG - Intergenic
917669653 1:177261204-177261226 ATGAGTTTATAGAGGTTGCAGGG + Intronic
921629301 1:217414481-217414503 ATGAGATGATGGAGGTGAAGTGG - Intergenic
923279384 1:232428107-232428129 ATGACTTTATGCAAGTGACTTGG - Intronic
924471103 1:244343415-244343437 ATGAATGAAGGGAGGTGACTGGG + Intergenic
1063005890 10:1970293-1970315 ATGAGATTATGGAGTAGACTGGG + Intergenic
1063235261 10:4107911-4107933 ATGTGATTATGGATGTGATTTGG + Intergenic
1064323630 10:14329092-14329114 ATGAGTTTATGGAGGTGACTTGG - Intronic
1066342057 10:34544775-34544797 ATGAATTTATGGATGTCACTTGG - Intronic
1066548347 10:36526366-36526388 ATGAGTTTATAAAGGTGTTTTGG - Intergenic
1067998973 10:51309245-51309267 AGGAGTTTATGAAAGAGACTGGG - Intronic
1068249263 10:54415921-54415943 GTGAATTTAAGGAGGTGAATAGG + Intronic
1068705173 10:60068132-60068154 AAGTGTTCATGTAGGTGACTAGG - Intronic
1068739088 10:60448655-60448677 TTGAGGTCATGGAGTTGACTGGG - Intronic
1070615239 10:77964594-77964616 ATGAGATTATGGAGTAGACTGGG + Intergenic
1075895518 10:125991227-125991249 ATGAGTGTGTGGTGGTGACCAGG + Intronic
1075909605 10:126112825-126112847 ATGAGTTTCAGGAGGACACTGGG - Intronic
1076499540 10:130926282-130926304 ATGAGTGTGTGTATGTGACTGGG + Intergenic
1076525530 10:131110306-131110328 GTGAGTTGAGGGAGGTGACACGG - Intronic
1077652519 11:3986291-3986313 ATGAATTTTTGGAGATGAATAGG + Intronic
1078945767 11:16067226-16067248 ATGAGATTTGGGAGGAGACTGGG + Intronic
1079220841 11:18559521-18559543 ATGAGTTAATAAAGATGACTTGG + Intronic
1079435101 11:20439260-20439282 ATGTGTTGATGGAGGTTGCTGGG + Intronic
1079980730 11:27149321-27149343 ATGAGTTTAGGGAGGGGCCAGGG - Intergenic
1087251495 11:95905155-95905177 ATGAGGTTAAGGAGGTGAGATGG - Intronic
1088412668 11:109552496-109552518 ATGAGGTTATCAAGGTAACTAGG + Intergenic
1088904218 11:114142080-114142102 TTGGGCTTCTGGAGGTGACTTGG + Intronic
1090611294 11:128473389-128473411 ATTAGTTTATGGAGAGCACTTGG - Intronic
1091084118 11:132703912-132703934 CTGATTCTATGAAGGTGACTTGG + Intronic
1092428933 12:8394388-8394410 ATGTGTTTATGGAGGGGATGTGG - Intergenic
1096965280 12:55621651-55621673 ATGAATATATGGATGTGACCTGG - Intergenic
1098219343 12:68252295-68252317 TTGAGTTTATAGTGGTGAATGGG - Intronic
1100557179 12:95707245-95707267 ATGAGACTAGAGAGGTGACTGGG - Intronic
1102463598 12:113115191-113115213 AACAGTTTATGAAGGTGAGTAGG - Exonic
1103899725 12:124296971-124296993 AGGAGTTGATAGAGGTGACCAGG + Intronic
1103936886 12:124481672-124481694 ATGAGGTCAGGGAGGTGACGGGG + Intronic
1105562997 13:21513077-21513099 TTGATTTTAGGAAGGTGACTAGG - Intronic
1106398485 13:29404519-29404541 ATGAGGTTAGGGAGGAGACGGGG - Intronic
1107367877 13:39704790-39704812 ATGAGTTTATAGCAGTGAATGGG + Intronic
1109038693 13:57301803-57301825 ATGAGATTATAGAGGTAAATTGG - Intergenic
1111139560 13:84098066-84098088 ATGAGATTAGAGAGGTAACTGGG - Intergenic
1113068396 13:106394232-106394254 ATGAGTTTATGGCTGGGAGTTGG - Intergenic
1114784215 14:25576187-25576209 ATGAGTTTGTTGAGGGGATTTGG + Intergenic
1115169723 14:30491161-30491183 ATTAGTTTATTGAAGTAACTAGG - Intergenic
1115515189 14:34178062-34178084 AGGAGTCTATGGGGGAGACTGGG + Intronic
1115620829 14:35138594-35138616 AGGTGTTTATGGAGGTCAGTTGG - Intronic
1116918653 14:50549420-50549442 ATGGGTTTATGTATGTGACTTGG - Intronic
1118051155 14:62029487-62029509 ATGAGTGTATGGAGATCATTTGG + Intronic
1119767094 14:77196938-77196960 AGGAGTTGCTGGAGGTAACTGGG - Intronic
1120948488 14:90020256-90020278 GTGAGTATAAGGAGGTGACATGG - Intronic
1121869355 14:97393001-97393023 ATCAGTTTTGGGAGGTGAGTGGG + Intergenic
1125053675 15:35332060-35332082 AGGAGTTTTTGTAGCTGACTTGG - Intronic
1128142152 15:65309839-65309861 AAGACTTCATGGAGGTGACAGGG + Intergenic
1130125956 15:81094328-81094350 ATGAGTGTAAGTAGGTGAATGGG - Intronic
1131105402 15:89730598-89730620 ACAAATTTATGGAGGTGACCAGG + Intronic
1131509170 15:93039876-93039898 GTTACTATATGGAGGTGACTTGG - Intronic
1132775921 16:1593975-1593997 ATGAGTTAATGGTGGTGAAGAGG - Intronic
1133187358 16:4109580-4109602 TTAAGTTTCTGGAAGTGACTTGG - Intronic
1133523544 16:6581724-6581746 CTGTGTTTATGGAGGTCACCTGG + Intronic
1134079542 16:11315599-11315621 ATGAGTGTATGGAGGAGATGGGG - Intronic
1139083798 16:63560482-63560504 ATGAGATTTTGGAGGGGCCTGGG - Intergenic
1139631290 16:68233491-68233513 ATGTGTCTATGGAGGGGAGTTGG - Intronic
1141607723 16:85164550-85164572 ATGAGTGCATGGAGGTGAACCGG + Intergenic
1143274660 17:5701234-5701256 ATGACTTTAGGGAGGTGGCCAGG + Intergenic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1149333061 17:55606446-55606468 TGGAGTTTATAGAAGTGACTTGG - Intergenic
1150075949 17:62192210-62192232 ATGAATATTTGGAGGAGACTGGG - Intergenic
1151901111 17:77015915-77015937 ATGAGTATCTGGAGGTGGCCCGG + Intergenic
1152228922 17:79105126-79105148 AGGACTGTGTGGAGGTGACTGGG - Intronic
1152440795 17:80308343-80308365 GAGAGTTGATGGAGGGGACTGGG - Intronic
1154308801 18:13252021-13252043 ATGATTGTTTGGAGGGGACTTGG + Intronic
1155352900 18:24924307-24924329 ATGAGAGTAAGGTGGTGACTTGG + Intergenic
1157192130 18:45590471-45590493 AGGAGTCTCTGGAGGTGAATTGG + Intronic
1157865087 18:51175959-51175981 AAGAGTTTATGGAGGGTACTTGG - Exonic
1158881026 18:61779765-61779787 ATCAGCTTATGGTGGTAACTGGG - Intergenic
1161192947 19:2969454-2969476 GTGAGTTTGTGGAAGTGGCTAGG - Intergenic
1166103876 19:40588200-40588222 ATGAGGGTATGGAGGTGACAAGG + Intronic
1167620975 19:50560482-50560504 ATGAGTTTAGGGAAATGCCTGGG + Intronic
925436239 2:3840297-3840319 ATGAGATTTAGGAGGTGACAGGG - Intronic
925970874 2:9105764-9105786 ATGAGTTTATCCAGGTCACCAGG - Intergenic
926748517 2:16180095-16180117 ATGAGTTTAAGCAGGTCACTTGG + Intergenic
927865646 2:26585672-26585694 ATGAGATTAAGGAGGTAAGTAGG - Intronic
928162257 2:28939126-28939148 AGGGGTTTTGGGAGGTGACTTGG + Intronic
928162264 2:28939162-28939184 AGGAGTTTTGGGAGGTGACTTGG + Intronic
928162273 2:28939198-28939220 AGGGGTTTTGGGAGGTGACTTGG + Intronic
928277500 2:29916478-29916500 ATCAGTTATTGGAGGTGAATTGG - Intronic
928717553 2:34079501-34079523 TTGATTTTATGGAGGTCATTGGG + Intergenic
930682493 2:54271836-54271858 GTGAGTTTATCAAAGTGACTAGG - Intronic
933210083 2:79556345-79556367 AAGATTTTATAGTGGTGACTTGG + Intronic
934150491 2:89143477-89143499 ATGCATTTAGGGAGCTGACTGGG - Intergenic
938131010 2:128715605-128715627 GTGAGTTAATGGAGATGACCCGG + Intergenic
938227708 2:129630274-129630296 ATGACCTTATTGAGGTGGCTGGG - Intergenic
940010174 2:149044967-149044989 ATGTATTTTTGGAGGGGACTAGG + Intronic
940014760 2:149092394-149092416 GTGAGTATGTGGAAGTGACTAGG + Intronic
940976186 2:159947579-159947601 ATGATTTCAGGGTGGTGACTGGG + Intronic
941673888 2:168323784-168323806 GTGGGTTTATGGAGATGTCTGGG - Intergenic
941695604 2:168548021-168548043 GGGACTTTGTGGAGGTGACTGGG + Intronic
941734231 2:168955637-168955659 ATGAGTTTTTGGAGGGGTCAGGG - Intronic
941892018 2:170592447-170592469 ATGGGTTTATTGAGGTGTTTGGG - Intronic
942134745 2:172913485-172913507 TTGAGTGGCTGGAGGTGACTTGG + Intronic
942249264 2:174033798-174033820 ATGAGCTTAGGGAGGTTACTGGG + Intergenic
944202872 2:197126622-197126644 AAGAGGTTAGGGAGCTGACTGGG - Intronic
945254524 2:207792388-207792410 ATGGCTTTCTGGAGGTGGCTAGG - Intergenic
945996420 2:216440572-216440594 CTGTGTTTATGAAGGTGTCTTGG + Intronic
946741928 2:222811199-222811221 ATGAGTTGATGATGCTGACTTGG + Intergenic
1169532288 20:6498550-6498572 TAGAGTTGATGGAGGGGACTTGG + Intergenic
1169967000 20:11229011-11229033 CTTAGTGTATGGATGTGACTTGG + Intergenic
1171327887 20:24311724-24311746 ATGAGTTAATGGAGGTGTGTGGG - Intergenic
1171428169 20:25061463-25061485 ATAACTTTATGTAGGTGACAGGG - Intergenic
1172271554 20:33658281-33658303 ATGGGCTAAAGGAGGTGACTGGG - Intronic
1173473369 20:43340437-43340459 AAGAGTTTTTGGAGGTGGATTGG + Intergenic
1174087191 20:48017857-48017879 CTGGGCTTATGGAGGGGACTGGG + Intergenic
1175792202 20:61746734-61746756 ATGAGGTTATGGAGGTCAGGAGG + Intronic
1177049442 21:16213759-16213781 ATGAGTCTGTAGAGGTGTCTTGG + Intergenic
1179087230 21:38228478-38228500 ATGTATTTAAGGTGGTGACTGGG - Intronic
1180743325 22:18068974-18068996 GTCAGTTTATGGAGGTATCTAGG - Intergenic
1183981124 22:41540923-41540945 ATGAGTTTGTGGAGGGGACCAGG + Intronic
953564040 3:44015903-44015925 GTGGGTTTATGGAGGTAACTGGG - Intergenic
953820892 3:46206645-46206667 GGGGGTGTATGGAGGTGACTCGG - Intronic
954421801 3:50422819-50422841 ATGAGTCTGTGAGGGTGACTCGG - Intronic
955066281 3:55536158-55536180 AGAAGCTTAAGGAGGTGACTTGG - Intronic
955278881 3:57574700-57574722 AACAGTTTATGGAGGAGACCAGG - Intronic
958173630 3:89967648-89967670 ATGAGTTTATGATGGTGAGGTGG - Intergenic
959293630 3:104506506-104506528 ATGGGATTATGCAGGTGAATGGG - Intergenic
960400009 3:117185136-117185158 ATGTGTTTATGGAGATATCTAGG + Intergenic
961491561 3:127259936-127259958 ATGACTTTAAGGAGGTTTCTGGG - Intergenic
962058889 3:131904381-131904403 ATGGGTTTATGGGGCTGAGTGGG - Intronic
963269378 3:143270540-143270562 ATGTCTTTATGGAGGTGAGGTGG + Intronic
965149328 3:164949695-164949717 ATGTGTTTATGGAGGGGTGTGGG + Intergenic
967458742 3:189720985-189721007 ATGCCTTTATGGACATGACTGGG - Intronic
969093189 4:4712161-4712183 TTTAATTTATGGAGGTGACTGGG + Intergenic
970495519 4:16621028-16621050 AAGAGTTTGTGGAGTTGAATTGG - Intronic
973616301 4:52681717-52681739 ATGAGTTGATGGATATGCCTTGG - Intergenic
973998685 4:56487216-56487238 ATGAGTTGAAGGAGGGGAGTTGG + Intronic
974608362 4:64183232-64183254 ATGAGATTTGGGAGGTGACAAGG - Intergenic
979057647 4:116016283-116016305 ATGTATTTAAGGTGGTGACTGGG + Intergenic
980430068 4:132683252-132683274 ATGAGATTTTGGAGGTGCCAAGG - Intergenic
981513329 4:145581251-145581273 ATGAGTTAATGGATTTTACTAGG - Intergenic
981538199 4:145822473-145822495 TTGAGTATGTGGAGGAGACTTGG + Intronic
982505166 4:156207992-156208014 ATGAGTTTATGAGGGTGTCAAGG + Intergenic
983557733 4:169073403-169073425 AAGAATTTGTGGAGGTGATTGGG - Intergenic
983645969 4:169991822-169991844 AGGAGATTATGGAGGTGGTTGGG - Exonic
985197506 4:187448153-187448175 ATGGTTTTATGGAGGAGAATGGG - Intergenic
989277454 5:39606294-39606316 TTCAGTTTATGTAGGTGACAAGG + Intergenic
989533335 5:42533983-42534005 ATGAATTAATGGCAGTGACTTGG - Intronic
990484369 5:56243316-56243338 ATGAGATTAGGGAGGCGACAAGG + Intergenic
990602397 5:57372733-57372755 ATGAGTTAATAAAGGTGACTTGG - Intergenic
991525813 5:67556611-67556633 ATGAGTTTTTGGATATGACCCGG - Intergenic
992601525 5:78405496-78405518 ATAAGTTTATAAAGGTGATTGGG - Intronic
993736066 5:91477679-91477701 ATGAGTATTTGGGGGTGGCTGGG + Intergenic
995735914 5:115298705-115298727 AGGAGATAATGGAGGTGACGAGG + Intergenic
996520059 5:124416176-124416198 AAGAGTTTTAGGTGGTGACTAGG + Intergenic
997431307 5:133842998-133843020 CTGAGTTTCTGGTGGTGTCTGGG - Intergenic
1003069863 6:2937436-2937458 ATGAATTTGTGGAGGGGGCTGGG + Intergenic
1007029504 6:38615431-38615453 ATGAGTTTGGGGAGGTGGTTGGG - Intronic
1007212308 6:40205472-40205494 AGGAGTTTATGGCAGTGACAGGG + Intergenic
1012240047 6:96860908-96860930 ATGAGGTTTTGGAGGGGACAGGG + Intergenic
1017919887 6:158862395-158862417 ATCAGCTTAGGAAGGTGACTTGG + Intergenic
1018039405 6:159908854-159908876 ATGACTTCCTGGGGGTGACTGGG + Exonic
1018564544 6:165137411-165137433 ATGAGATTTTGGAGGGGACAGGG + Intergenic
1020363831 7:7358223-7358245 AGGAGGTTAGGGAGGTGAGTGGG + Exonic
1020368484 7:7406327-7406349 ATGAATGTATGGAGGCTACTTGG - Intronic
1020638263 7:10723284-10723306 ATGAGTGTCTGGGGGTGACCAGG + Intergenic
1020809423 7:12833376-12833398 ATGAGGTTTTGGAGGTGCCAGGG - Intergenic
1024628831 7:51230986-51231008 AAGACTTTAGGGAAGTGACTGGG + Intronic
1024838432 7:53553723-53553745 ATCAGTTTCTGGATGTGTCTTGG - Intergenic
1024847956 7:53671955-53671977 ATGAGGTATTTGAGGTGACTGGG - Intergenic
1026372564 7:69716347-69716369 CTTAGATTAGGGAGGTGACTAGG + Intronic
1027486883 7:78772607-78772629 AGGTGTTGATGGAGGGGACTGGG - Intronic
1027698878 7:81443950-81443972 GTGAGTGTATGGAGGTGGCGGGG + Intergenic
1031118717 7:117696303-117696325 AAGACTTTATGGAGGTGGCTTGG + Intronic
1031300988 7:120060572-120060594 ATGTATTTAAGGTGGTGACTTGG - Intergenic
1031568738 7:123331053-123331075 ATGAATTTATGCTGGTGTCTGGG - Intergenic
1032774025 7:135091065-135091087 ATGTGTTGATGGAGGTTACTGGG + Intronic
1032833483 7:135652137-135652159 ATGACTTTAAGAAGATGACTGGG + Intergenic
1033491265 7:141846013-141846035 ATGATTTCTGGGAGGTGACTTGG - Intergenic
1033579306 7:142717094-142717116 GTGAGTTCATGGTGGTGTCTCGG - Intergenic
1036699087 8:10999774-10999796 TTGGGTTGATGCAGGTGACTCGG + Intronic
1039306067 8:36264396-36264418 ATGAGGATATGGAGATGACAGGG - Intergenic
1041180971 8:55247647-55247669 ATGAGATCATGAAGGTGACTCGG - Intronic
1044953849 8:97459588-97459610 ATGAGTCTATGGGGCTGGCTGGG - Intergenic
1045738685 8:105326785-105326807 ATATTTTCATGGAGGTGACTTGG + Intronic
1055175467 9:73313233-73313255 ATGAGATTTTGGAGGGGCCTGGG - Intergenic
1055718411 9:79144222-79144244 ATGAGGTTATTGAAGTTACTGGG + Intergenic
1056170797 9:83982128-83982150 ATGAGTTTATGTAGGGGCTTAGG + Intronic
1057546862 9:96025509-96025531 CTGAGTTTCTGGAGATGACTAGG + Intergenic
1058304528 9:103422103-103422125 ATGAGTTAATGTAGGATACTTGG + Intergenic
1058685688 9:107477807-107477829 ATGAGCTTCTGGAGGGCACTAGG - Intergenic
1059134322 9:111790374-111790396 ATGATTTTATAGAGATAACTGGG + Intronic
1060803443 9:126558975-126558997 GAGAGTGGATGGAGGTGACTGGG - Intergenic
1185736868 X:2501542-2501564 AGGAGTCTATGGATCTGACTTGG - Intronic
1185762752 X:2701032-2701054 ATGAGTTTAGGTGGGTGAGTAGG - Intronic
1185977381 X:4736724-4736746 AAGATTTTATGGTGGTGACAAGG + Intergenic
1187380589 X:18798390-18798412 ATGACTTGATTGAGGTGTCTTGG + Intronic
1188016989 X:25116811-25116833 ATGAGTGAATGCAAGTGACTTGG - Intergenic
1188070505 X:25712650-25712672 ATGACTTTATCAAGGTAACTTGG - Intergenic
1188309640 X:28600481-28600503 TTGAGTTTAAGGAGGGGATTTGG + Intronic
1188655223 X:32685714-32685736 ATGACTTTATGTAGCTGAATTGG + Intronic
1191126816 X:56964827-56964849 ATGACTTTTGGGAGGTGATTAGG + Intergenic
1192385995 X:70670569-70670591 ATTTGTTTCTAGAGGTGACTTGG - Intronic
1192398146 X:70805694-70805716 AGGAGATTATGGAGGAGGCTGGG - Intronic
1194484617 X:94471948-94471970 ATGAGATTTGGGAGGTGACAGGG + Intergenic
1197557528 X:127974935-127974957 CTGACTTCTTGGAGGTGACTTGG - Intergenic
1199511565 X:148628362-148628384 ATGAGTCTATGGAGATAACTGGG + Intronic
1202095931 Y:21248216-21248238 ATGTGTTTAAGGAAGTGACAGGG - Intergenic