ID: 1064327852

View in Genome Browser
Species Human (GRCh38)
Location 10:14367241-14367263
Sequence CTAAGGCTTCTCCTCCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064327852_1064327854 -10 Left 1064327852 10:14367241-14367263 CCCTCATGGAGGAGAAGCCTTAG 0: 1
1: 0
2: 2
3: 19
4: 201
Right 1064327854 10:14367254-14367276 GAAGCCTTAGTTGTCCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064327852 Original CRISPR CTAAGGCTTCTCCTCCATGA GGG (reversed) Intronic
900012829 1:131452-131474 CCAGGGCTCCTCCTCCATGGTGG - Intergenic
900042894 1:487439-487461 CCAGGGCTCCTCCTCCATGGTGG - Intergenic
900064331 1:722436-722458 CCAGGGCTCCTCCTCCATGGTGG - Intergenic
900885800 1:5414546-5414568 CTTATGCTTCTCTCCCATGAGGG - Intergenic
901323952 1:8356077-8356099 GTAAGACTTCCCCTCCAGGAGGG - Intronic
901654221 1:10760121-10760143 CTACAGCTTCTCCTCTATGAAGG + Intronic
902922489 1:19675023-19675045 CATTGGCTTCTGCTCCATGAGGG + Intronic
906745186 1:48216565-48216587 ATAAGACTTCTCCTCCCTGCAGG + Intergenic
906955344 1:50369539-50369561 CCAAGGGTCCTCCTCCATGTAGG - Intergenic
907321609 1:53606269-53606291 CTAGGGCTGCTCTTCCATGGCGG - Intronic
909780979 1:79546885-79546907 CTAATGATTCTCTTCAATGAGGG - Intergenic
909921507 1:81386845-81386867 CTGAGGCTTCTCCTGTGTGATGG - Intronic
912697305 1:111850932-111850954 CTTAGGTTTCTCCTCAATGTTGG + Intronic
916962837 1:169906479-169906501 CTAAGGCTTAGACTCCAGGAGGG - Intergenic
917328390 1:173856719-173856741 CTAAGGCAATTCCTCCATGAGGG - Exonic
917534450 1:175864272-175864294 ATAAGGCTTCCCCTCCAGGAGGG + Intergenic
917578965 1:176354832-176354854 CTGAGGCTTTTCCTCCAGAAGGG - Intergenic
920523073 1:206643724-206643746 CTATGCCTTCTGCTCAATGAGGG - Intronic
922261268 1:223947942-223947964 CCAGGGCTCCTCCTCCATGGTGG - Intergenic
923433431 1:233946685-233946707 CACACGTTTCTCCTCCATGAAGG - Intronic
923628294 1:235632050-235632072 CTAAGCCTTGCCCTGCATGACGG - Intronic
924098445 1:240578858-240578880 CTAGGGCTTCTCATTCATTAGGG - Intronic
924342431 1:243050122-243050144 CCAGGGCTCCTCCTCCATGGTGG - Intergenic
1063141180 10:3257805-3257827 CTTCAGCTCCTCCTCCATGAAGG - Intergenic
1064327852 10:14367241-14367263 CTAAGGCTTCTCCTCCATGAGGG - Intronic
1066734042 10:38455433-38455455 CCAGGGCTCCTCCTCCATGGTGG + Intergenic
1069524612 10:69157943-69157965 CTCAGGCTTCTCCTCCTTGCTGG - Intronic
1069931086 10:71882078-71882100 CTGAGGTTTCTCCCACATGATGG + Intergenic
1070021214 10:72587895-72587917 CTGAGGCTTCTCCTGTGTGATGG + Intronic
1074193616 10:111159978-111160000 CTAGGGCTTCTGCTATATGAAGG - Intergenic
1074366482 10:112861519-112861541 ATAAGGCTCCTCCACCATGTAGG - Intergenic
1075984895 10:126776500-126776522 GTGAGGCCTCTCCCCCATGATGG + Intergenic
1076969167 11:123656-123678 CCAGGGCTCCTCCTCCATGGTGG - Intergenic
1084584631 11:70050467-70050489 CTATGGCTCCTCCTCCCTGTAGG + Intergenic
1084903364 11:72327137-72327159 CTAAGGCAGCCCCTCCATGGTGG + Intronic
1088267330 11:108000427-108000449 CCAAGGCTTTTCCTGCCTGAAGG - Intergenic
1089916726 11:122164379-122164401 CTGAGGCTTCACCTCCATGTAGG - Intergenic
1090261833 11:125326894-125326916 CTCAGGCTTCACCTCCCTGCTGG - Intronic
1090356043 11:126140897-126140919 TTCAGGCTTCTCCTCCTTGATGG - Intergenic
1091983376 12:4884900-4884922 CTAAGGCTGCTGCTCCAAAATGG - Intergenic
1095501648 12:42846470-42846492 CTAAGACTTCCTCTCCAAGAGGG - Intergenic
1097153827 12:56998250-56998272 CTAAGGCCTCCCATCCATGGAGG + Intergenic
1097196537 12:57245179-57245201 CTCTGGCTCCTCCTCCATCATGG + Exonic
1097650988 12:62297048-62297070 CTGAGGCTTCTCTCCCAGGAAGG + Intronic
1098262726 12:68687189-68687211 CTAAGGCTCCTTCCCCATGCCGG + Intronic
1105581545 13:21701611-21701633 TAAAGGCTTCTCCTCCTGGAGGG + Exonic
1106014091 13:25851699-25851721 TTAAGGGTTCCCCTCCATGCAGG + Intronic
1107770516 13:43785048-43785070 TTAACGCATCTCCTCCAAGAGGG + Intronic
1108705749 13:52984364-52984386 CAAAGGCTTGTCCTACATGGTGG + Intergenic
1109276546 13:60310284-60310306 CTAAAAGTTCTCCTCCAGGAGGG - Intergenic
1112065692 13:95790414-95790436 CTAAGGCTCCTCAGACATGAGGG - Intronic
1113057830 13:106288621-106288643 CTGTGCCTTCTACTCCATGATGG - Intergenic
1113282147 13:108800021-108800043 CTAAGGCTTCCCCATGATGATGG - Intronic
1115517514 14:34200501-34200523 CAAATGGTTCTCATCCATGAAGG - Intronic
1115924245 14:38412981-38413003 CTAAGCCTGCTCATCCATGGAGG - Intergenic
1118253850 14:64187863-64187885 CTAAGGGTCCTCCTCCTTAAAGG - Intronic
1121222764 14:92299037-92299059 CTAAGGCTTCACCTTCAGGGAGG - Intergenic
1121607469 14:95251952-95251974 CTAATCCTTCTCCTCCATGGGGG - Intronic
1121992132 14:98568459-98568481 CTAGGGCTTCTCCTACTTGAAGG + Intergenic
1124039088 15:26083529-26083551 CATAGGCTTCCTCTCCATGAAGG - Intergenic
1124870717 15:33539339-33539361 AACAGGCTTCTCCTACATGAAGG - Exonic
1126314542 15:47356217-47356239 TTAAGGATTATCCTCCCTGAGGG - Intronic
1129607615 15:77032502-77032524 CTAGGGCTTCTCTGCCCTGAAGG - Intronic
1130410325 15:83642522-83642544 CTAAGGCTTGTCCTCTAAGAGGG - Intergenic
1130515264 15:84621511-84621533 ATAGGGCTTCTCCACCATGTGGG - Exonic
1134605283 16:15566006-15566028 CTAAGGCTTCTTCTCCATGTTGG - Intronic
1135233051 16:20727680-20727702 CTGAGATTTCTCCTGCATGAGGG - Intronic
1138512691 16:57517802-57517824 GTAAGTCTTCAGCTCCATGAGGG + Intronic
1139588700 16:67920810-67920832 CTAAGCCTTCTGCTCCAAGCTGG - Intronic
1139922263 16:70467720-70467742 CTGAGATTTCTACTCCATGATGG - Intronic
1141659697 16:85435350-85435372 GGAAGGCTGCTCCTCCATGGAGG - Intergenic
1142451508 16:90175466-90175488 CCAGGGCTCCTCCTCCATGGTGG + Intergenic
1142596844 17:1033902-1033924 CAAAGCCATCTCCTCCAGGAAGG + Intronic
1142915296 17:3131597-3131619 GAAAGGCTTGTCCTACATGAGGG - Intergenic
1143151098 17:4807903-4807925 CGAACGCCTCTCCTCCCTGAGGG - Intronic
1144396498 17:14849135-14849157 TTAAGGCTCCTCCCCCAAGAAGG + Intergenic
1148124530 17:45230000-45230022 CTCAGCCTTCTCCTCCAAGTGGG + Intronic
1148290029 17:46437734-46437756 CTAAGATTTCTCCCTCATGATGG - Intergenic
1148312197 17:46655306-46655328 CTAAGATTTCTCCCTCATGATGG - Intronic
1148352535 17:46951095-46951117 CAAAGGCTTCTCCAGCTTGAGGG + Intronic
1148381648 17:47203916-47203938 CTAAGGCTGCTTTTCCCTGATGG - Intronic
1148770418 17:50063064-50063086 CCAAGGCTTGTCCTCTAAGATGG + Intronic
1148834087 17:50456250-50456272 AAGAGCCTTCTCCTCCATGAAGG - Intronic
1150627518 17:66851051-66851073 CTGAGACTCCCCCTCCATGAAGG + Intronic
1151026086 17:70678585-70678607 CTCAGGTTTCTCCTCCATGATGG + Intergenic
1152462229 17:80447440-80447462 AAAAGGCTTTCCCTCCATGAAGG + Intergenic
1152565099 17:81096812-81096834 CTGAGGCTCCTTCTCCAGGAAGG - Intronic
1153305278 18:3625147-3625169 CTAGGGCTTCATCTCTATGAAGG - Intronic
1153558281 18:6340996-6341018 CTAAGACTTCTCCTGTAAGAAGG + Intronic
1154338906 18:13487425-13487447 CAAAGGCTTCTCTGCCCTGATGG + Intronic
1157730636 18:50001243-50001265 AGAAGGCTTTACCTCCATGATGG + Exonic
1159756472 18:72371653-72371675 CAAAGGCATGTCCTACATGATGG - Intergenic
1160645972 19:193582-193604 CCAGGGCTCCTCCTCCATGGTGG - Intergenic
1162725599 19:12688338-12688360 ATAGGGCTTCTTCTCCTTGAAGG - Intronic
1165848831 19:38837139-38837161 CTCAGGCTTGTCCTCCAGGGAGG - Intronic
1167571902 19:50293569-50293591 CTGACGCTTCTCCTCCAGAATGG - Exonic
925739908 2:6996289-6996311 CAAAAGCTTCTCTTCCAAGATGG + Intronic
925926697 2:8676306-8676328 CTAAGGCTGCATCTCCAGGAGGG - Intergenic
927403853 2:22745854-22745876 CTTAAACTTCTCTTCCATGAAGG - Intergenic
927474665 2:23403433-23403455 CTCAGGATTCTCTTCCATGCTGG + Intronic
927727599 2:25438663-25438685 GTTAGGCTTCACCTCCTTGAGGG - Intronic
928233506 2:29520632-29520654 ATAGGTCTTCTCCTCCAAGAAGG - Intronic
928662488 2:33517425-33517447 CTAAGGCTCCCCCTCCCTGTAGG - Intronic
929030485 2:37646126-37646148 CTGAGCTTTTTCCTCCATGACGG + Exonic
929176036 2:38977175-38977197 CTAATACATCACCTCCATGAGGG + Intergenic
929676906 2:43943583-43943605 CCAAGGCTTCCCCATCATGAGGG + Intronic
930182973 2:48383286-48383308 GTCAGGTTTCTCCACCATGAAGG - Intergenic
930429879 2:51262269-51262291 CAAAGGCTTCTCATCCGTAATGG - Intergenic
931301123 2:60979332-60979354 CTTAAGCTTCTGCTCCATCAGGG + Intronic
931856136 2:66303422-66303444 TGGAGGCTTCTCCTCCATGCTGG - Intergenic
933840312 2:86281186-86281208 CTAATGGTTCTCCTGCCTGAAGG + Intronic
935055718 2:99564939-99564961 CAAACACTTATCCTCCATGATGG - Intronic
936225128 2:110642187-110642209 CAAAGGCTCCTTCTCCAAGAAGG + Exonic
938102553 2:128507021-128507043 CTTAGGCTTTTCCTCCAAAATGG + Intergenic
940183734 2:150960814-150960836 CCAAGGCTTGGCATCCATGATGG - Intergenic
941212793 2:162663024-162663046 GTAAGGCTTCTCTTACATGGTGG + Intronic
942127315 2:172840151-172840173 ATATGGCTTCTCTTCCATTAAGG + Intronic
944371460 2:198988218-198988240 CTAATACTTCTCCTCCATTTAGG - Intergenic
944880606 2:204009036-204009058 CTAAGGCTTTTGCTACATCATGG + Intergenic
948187568 2:236033647-236033669 CACAGGCTTCTCCTGCATGCTGG + Intronic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1170813444 20:19693395-19693417 CGCAGCCTTCTCCTACATGATGG + Exonic
1171178181 20:23070633-23070655 CTAAGGCTTCCCCTGTGTGATGG + Intergenic
1173181182 20:40807434-40807456 CCAAGATTTCTCCTCCAAGAGGG + Intergenic
1174273154 20:49384216-49384238 CTAAAGTGTCACCTCCATGAGGG + Intronic
1175320824 20:58087070-58087092 CTAAACCGTGTCCTCCATGAGGG + Intergenic
1175823447 20:61924166-61924188 CTAGGGCTTCCCCTCCACGTTGG - Intronic
1176279534 20:64292634-64292656 CCAGGGCTCCTCCTCCATGGTGG + Intergenic
1176926331 21:14753830-14753852 TCAAGGCTTCTCCTTCAAGAGGG + Intergenic
1178159351 21:29893915-29893937 CTAATGCTTCACCTCCCTGAAGG - Intronic
1178635446 21:34298337-34298359 ATCTGGCATCTCCTCCATGATGG + Intergenic
1178794917 21:35735045-35735067 CTAAGGGTTCCCCTACAAGATGG + Intronic
1183282898 22:36942154-36942176 CTCAGGGTTCCCCACCATGAAGG - Intergenic
950628632 3:14266933-14266955 CTCAGCCTTCTCATCCATCAGGG - Intergenic
958424756 3:93967269-93967291 CCTATGCTGCTCCTCCATGATGG - Intronic
959267937 3:104167738-104167760 GTAGAGGTTCTCCTCCATGAGGG + Intergenic
963234237 3:142940653-142940675 GTAAGTCTTCTCTTCCCTGAGGG - Intergenic
963535096 3:146517869-146517891 CTAAGGCAACTCCTCTAGGAGGG + Intronic
965108863 3:164395089-164395111 CTGAGGGCTCTCCTGCATGATGG - Intergenic
965517780 3:169640539-169640561 CTAAGGCTTCTCTTCTGTAAGGG + Intronic
966962834 3:184957715-184957737 CTGAGGTCTCTCCTACATGATGG - Intronic
968046776 3:195628553-195628575 GCAGGGCTTCTCCTCCAGGAAGG + Intergenic
968307878 3:197661491-197661513 CCAGGGCTTCTCCTCCAGGAAGG - Intergenic
968371709 3:198225944-198225966 CCAGGGCTCCTCCTCCATGGTGG + Intergenic
968630204 4:1646583-1646605 GCAAGGCTTGTCCTCCATGGGGG - Intronic
970482382 4:16489476-16489498 CTCAGGTTTTTCCTCCATGAGGG + Intergenic
971977332 4:33707614-33707636 CTGAGGCTTCCCCTCAAGGAGGG - Intergenic
972956154 4:44394931-44394953 TCAAGGCTTTTCCTTCATGATGG + Intronic
974004469 4:56542381-56542403 CTGAGACCTCTCCTGCATGATGG + Intronic
974331730 4:60488035-60488057 CTATGGCTTCTGCTCCAGGTAGG + Intergenic
974349289 4:60723888-60723910 CTGAGGCCTCTCCTGCGTGATGG - Intergenic
975489329 4:74971219-74971241 CAAAGGCATGTCCTACATGATGG + Intronic
977225293 4:94386671-94386693 CTAAAGCTTGGCATCCATGATGG + Intergenic
979260397 4:118638422-118638444 CCAGGGCTCCTCCTCCATGGTGG + Intergenic
980195647 4:129584470-129584492 GTAAGGCTTTTCCTCTAAGAGGG + Intergenic
980386796 4:132096260-132096282 TTAAGGCTTCTCCTCCCACAGGG + Intergenic
985744840 5:1640598-1640620 CCAGGCCTTCTCCTCCAGGAAGG - Intergenic
987160812 5:15140232-15140254 CTGAGACTTCTCCTTCAGGAGGG + Intergenic
988875576 5:35442246-35442268 CTAATGCTTCATCTCCTTGAAGG - Intergenic
997759610 5:136432688-136432710 CAATGGCATCTCCTCCATGAAGG - Intergenic
1002730949 5:181331490-181331512 CCAGGGCTCCTCCTCCATGGTGG + Intergenic
1002753584 6:142614-142636 CCAGGGCTCCTCCTCCATGGTGG - Intergenic
1004387748 6:15187191-15187213 CTAAGGCCTCCCATTCATGAGGG - Intergenic
1004907066 6:20246046-20246068 CTGAGGTCTCTCCTGCATGATGG - Intergenic
1012862167 6:104572973-104572995 GTGAGTCTTCTCCCCCATGAGGG - Intergenic
1014475484 6:121867030-121867052 CTGAGGCCTCTCCTGCATGATGG + Intergenic
1015345040 6:132146586-132146608 CTAAGGTTTCACTTCAATGAAGG - Intergenic
1017979321 6:159385691-159385713 GTAAGGCTTCTCCAGCATGTGGG + Intergenic
1018276058 6:162132835-162132857 CTAAGCCGTCTCCTCTAAGATGG - Intronic
1024076092 7:45818652-45818674 CCAGGGCTCCTCCTCCATGGTGG + Intergenic
1024781028 7:52848223-52848245 ATAATGCTTCACCTCCTTGAAGG + Intergenic
1025060112 7:55798388-55798410 CCAGGGCTCCTCCTCCATGGTGG - Intronic
1025128311 7:56362800-56362822 CCAGGGCTCCTCCTCCATGGTGG - Intergenic
1025176694 7:56805681-56805703 CCAGGGCTCCTCCTCCATGGTGG - Intergenic
1025695098 7:63770705-63770727 CCAGGGCTCCTCCTCCATGGTGG + Intergenic
1026008505 7:66618403-66618425 CTAAGGCTTCTCCGCTCTGCAGG - Intergenic
1030207556 7:106965768-106965790 CTGAGGCTTCACCTACATGATGG + Intergenic
1032052627 7:128658415-128658437 CCAGGGCTCCTCCTCCATGGTGG + Intergenic
1032422198 7:131791435-131791457 CCAAGGCTTCTGTTCCATGCTGG - Intergenic
1034627025 7:152501552-152501574 CTTGATCTTCTCCTCCATGAAGG + Intergenic
1036411651 8:8507107-8507129 CTGATGCTCTTCCTCCATGAAGG - Intergenic
1042296110 8:67220050-67220072 CTAAGGCATAAGCTCCATGAGGG + Intronic
1042416194 8:68522404-68522426 CTAAGGCTTCTCTTTCTTTATGG - Intronic
1043890279 8:85646013-85646035 CTCACTCTTCTCCTCCTTGAGGG + Intergenic
1043891895 8:85658203-85658225 CTCACTCTTCTCCTCCTTGAGGG + Intergenic
1043894209 8:85724494-85724516 CTCACTCTTCTCCTCCTTGAGGG - Intergenic
1043894565 8:85727579-85727601 CTCACTCTTCTCCTCCTTGAGGG - Intergenic
1043894921 8:85730664-85730686 CTCACTCTTCTCCTCCTTGAGGG - Intergenic
1043895277 8:85733749-85733771 CTCACTCTTCTCCTCCTTGAGGG - Intergenic
1043897399 8:85748059-85748081 CTCACTCTTCTCCTCCTTGAGGG + Intergenic
1043897755 8:85751147-85751169 CTCACTCTTCTCCTCCTTGAGGG + Intergenic
1043898111 8:85754232-85754254 CTCACTCTTCTCCTCCTTGAGGG + Intergenic
1043899725 8:85766427-85766449 CTCACTCTTCTCCTCCTTGAGGG + Intergenic
1043901332 8:85778620-85778642 CTCACTCTTCTCCTCCTTGAGGG + Intergenic
1043901687 8:85781705-85781727 CTCACTCTTCTCCTCCTTGAGGG + Intergenic
1043903297 8:85793895-85793917 CTCACTCTTCTCCTCCTTGAGGG + Intergenic
1043904908 8:85806088-85806110 CTCACTCTTCTCCTCCTTGAGGG + Intergenic
1043906519 8:85818279-85818301 CTCACTCTTCTCCTCCTTGAGGG + Intergenic
1055929836 9:81548738-81548760 CAAAGGCATCACCTCCATCATGG - Intergenic
1056533810 9:87510481-87510503 CCTAGGCTACTCCTCCAGGAAGG + Intronic
1059593669 9:115692716-115692738 CTAAGGCCTCTCTTCTAAGAGGG - Intergenic
1061645782 9:132000175-132000197 CTAAGGCTTTTTTTCCATGAAGG - Intronic
1061941446 9:133886314-133886336 CTGAGACTCCTCCTCCAGGATGG - Intronic
1062755355 9:138283997-138284019 CCAGGGCTCCTCCTCCATGGTGG + Intergenic
1203579268 Un_KI270745v1:28169-28191 CCAGGGCTCCTCCTCCATGGTGG + Intergenic
1186927002 X:14344565-14344587 GTAATGCTCCACCTCCATGAGGG - Intergenic
1187219842 X:17313175-17313197 CTAAGACTTCTCCTCTAGGAAGG + Intergenic
1187585502 X:20657086-20657108 CAAAAGCCTCTCCTCCCTGAAGG - Intergenic
1190402203 X:50048404-50048426 GTTAGGTTTCACCTCCATGAGGG + Intronic
1192483516 X:71505269-71505291 GTAATGCTCCTCCTCCTTGAGGG - Intronic
1193106160 X:77676284-77676306 ATAAGGCTTCATCTCCTTGAGGG + Exonic
1194161157 X:90454126-90454148 CTTAGGCTGCTCTTTCATGAAGG + Intergenic
1195316460 X:103683953-103683975 CTAATGCATCTCTTCCAGGAGGG + Intronic
1196588440 X:117458258-117458280 CTCACTCTTCTCCTACATGAAGG - Intergenic
1197098523 X:122623925-122623947 CTAACCCTTGTCCTCCTTGATGG - Intergenic
1197578594 X:128254601-128254623 CTAAGCCTTTTGCTCCATAAAGG - Intergenic
1197729763 X:129799438-129799460 CCAAGACTCCTCCTCCAGGAAGG + Intergenic
1198190237 X:134296775-134296797 CTGAGGCTTCTCCCCCAGGATGG + Intergenic
1198195890 X:134361426-134361448 ATAAGTCTTCTGATCCATGATGG - Intergenic
1198608528 X:138371618-138371640 CTGAGACTTCTCCCCCATGATGG + Intergenic
1200507447 Y:4031056-4031078 CTTAGGCTGCTCTTTCATGAAGG + Intergenic
1202381876 Y:24280791-24280813 CCAGGGCTCCTCCTCCATGGTGG + Intergenic
1202488908 Y:25389334-25389356 CCAGGGCTCCTCCTCCATGGTGG - Intergenic