ID: 1064328381

View in Genome Browser
Species Human (GRCh38)
Location 10:14372105-14372127
Sequence CACAGGATGGTGAGGTAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064328375_1064328381 8 Left 1064328375 10:14372074-14372096 CCCTGCAAGTCACGGCTGCTGCA 0: 1
1: 0
2: 1
3: 14
4: 169
Right 1064328381 10:14372105-14372127 CACAGGATGGTGAGGTAGTCTGG No data
1064328373_1064328381 30 Left 1064328373 10:14372052-14372074 CCTCTGCATGAGGCAGTGAGGTC 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1064328381 10:14372105-14372127 CACAGGATGGTGAGGTAGTCTGG No data
1064328376_1064328381 7 Left 1064328376 10:14372075-14372097 CCTGCAAGTCACGGCTGCTGCAG 0: 1
1: 0
2: 2
3: 26
4: 210
Right 1064328381 10:14372105-14372127 CACAGGATGGTGAGGTAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064328381 Original CRISPR CACAGGATGGTGAGGTAGTC TGG Intronic
No off target data available for this crispr