ID: 1064332999

View in Genome Browser
Species Human (GRCh38)
Location 10:14411285-14411307
Sequence CTGCTTTCTTGGAAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 427}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064332999_1064333004 3 Left 1064332999 10:14411285-14411307 CCTTTTTTCTTCCAAGAAAGCAG 0: 1
1: 0
2: 1
3: 48
4: 427
Right 1064333004 10:14411311-14411333 TGGAGACGATGCCAAGACAAAGG No data
1064332999_1064333006 12 Left 1064332999 10:14411285-14411307 CCTTTTTTCTTCCAAGAAAGCAG 0: 1
1: 0
2: 1
3: 48
4: 427
Right 1064333006 10:14411320-14411342 TGCCAAGACAAAGGGAATTGAGG No data
1064332999_1064333005 4 Left 1064332999 10:14411285-14411307 CCTTTTTTCTTCCAAGAAAGCAG 0: 1
1: 0
2: 1
3: 48
4: 427
Right 1064333005 10:14411312-14411334 GGAGACGATGCCAAGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064332999 Original CRISPR CTGCTTTCTTGGAAGAAAAA AGG (reversed) Intronic
900384424 1:2403185-2403207 CTACTTTATGTGAAGAAAAAAGG - Exonic
901370178 1:8790568-8790590 CCATTTTCTAGGAAGAAAAAAGG + Intronic
905605193 1:39291852-39291874 CTGCTGGCTTGGTAGGAAAATGG - Intronic
905744983 1:40407968-40407990 TTTCTTTCTTGGGAGTAAAAGGG + Intronic
905967855 1:42114383-42114405 CTGTTTTCTTGTATGAGAAAGGG + Intergenic
906381359 1:45333926-45333948 CTGCTTTCTTACCAGTAAAATGG - Intronic
906804604 1:48768386-48768408 GAGCTTTCTTGTAAAAAAAATGG + Intronic
908643009 1:66245941-66245963 CTGCTCTCTTGAATGAAAACGGG - Intronic
908693626 1:66811297-66811319 ATGCTTTTATAGAAGAAAAATGG + Intergenic
910462255 1:87460158-87460180 TTGCTTTCTTTGGACAAAAAGGG + Intergenic
910928773 1:92422148-92422170 ATGCTTCCTTGGAGGAAGAATGG + Intergenic
911366091 1:96939114-96939136 ATGATTTCATGAAAGAAAAAGGG - Intergenic
911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG + Intronic
911536828 1:99110189-99110211 GTGCTGTCTAGGAAGAAAACAGG + Intergenic
913049864 1:115108081-115108103 CTGCTTTCTTTGAAGAATTGTGG + Intergenic
913194416 1:116443706-116443728 TTCCTTGCTTGGAAGAAAATGGG - Intergenic
913569336 1:120104561-120104583 CTGCCTTCTTGGGAGAGATAGGG + Intergenic
914290145 1:146265549-146265571 CTGCCTTCTTGGGAGAGATAGGG + Intergenic
914551188 1:148716332-148716354 CTGCCTTCTTGGGAGAGATAGGG + Intergenic
914667870 1:149847083-149847105 CTGCTTGCTTTGAAGACAGAGGG - Intronic
915099764 1:153490919-153490941 ATGCTTTCTTTGAAGAAATGGGG + Intergenic
915115864 1:153599099-153599121 CTGCTTTCTTGAGAGAAGATGGG - Intergenic
915703897 1:157825011-157825033 CTGCATTCTTGGAAGAATTGCGG - Intergenic
916979331 1:170116396-170116418 CTGATTTCTTGGAGGAAATATGG - Intergenic
917354047 1:174107495-174107517 CTGCTTTCTTGGTAGGTAGAGGG - Intergenic
917719964 1:177777963-177777985 CTGCTTTCTTTATAGAAAATAGG - Intergenic
919143424 1:193602563-193602585 TTGCTTTCTAGCTAGAAAAAGGG + Intergenic
920603601 1:207355940-207355962 CTGTTTTCTTCGAAAGAAAAAGG - Intronic
920686226 1:208110833-208110855 GTTCTTTCTAGGAAGAAGAATGG - Intronic
921744061 1:218717660-218717682 CTGTTTTCTGGAAAGAAAACTGG + Intergenic
921938161 1:220813715-220813737 CTGCGCTCTTGGTAGATAAACGG - Exonic
921964374 1:221072490-221072512 TTGCTTTCATGTAAGAAAATTGG - Intergenic
922318977 1:224467973-224467995 CTGATTTTTTTAAAGAAAAAAGG - Intronic
924363061 1:243261210-243261232 CTTCCTTCTTGGAAGAAAAGAGG - Intronic
924478883 1:244408633-244408655 CTCCTTTCTTGAAAAAAAAAAGG - Exonic
924820802 1:247488370-247488392 CTACTTTCTGGGAAGAACAAGGG + Intergenic
924873843 1:248078510-248078532 CAGCTGTTTTGGAAAAAAAAGGG + Intronic
1063300695 10:4846375-4846397 CTATTTTCAAGGAAGAAAAATGG + Intronic
1063760427 10:9068219-9068241 TTCCTTTCTTGGAAAGAAAAGGG - Intergenic
1063834208 10:9994163-9994185 ATACTTTCTTGGAAATAAAAGGG - Intergenic
1064332999 10:14411285-14411307 CTGCTTTCTTGGAAGAAAAAAGG - Intronic
1064865156 10:19871176-19871198 CTGTTCTTTAGGAAGAAAAATGG - Intronic
1065112174 10:22451293-22451315 CTGCTTCCTTAGAACAAAATTGG + Intronic
1065187483 10:23183091-23183113 GTGCTTTCATTGAAGAAATATGG + Intergenic
1065423415 10:25573233-25573255 TTCCTTACTTGGGAGAAAAAAGG + Intronic
1065825557 10:29567449-29567471 CTGCTTCCTTAGAAGAAATCTGG - Intronic
1065979271 10:30875503-30875525 TTGCTTGCTTGGATAAAAAAAGG + Intronic
1066146651 10:32565542-32565564 CTACTTTCTAGGAAGTAAGAAGG - Exonic
1066650163 10:37647504-37647526 CTGCTATCTTGGTTTAAAAATGG + Intergenic
1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1066966479 10:42270944-42270966 CTGCTTTTGGTGAAGAAAAAAGG - Intergenic
1067537707 10:47126771-47126793 CTTCTTTATTGATAGAAAAAAGG - Intergenic
1069082634 10:64104627-64104649 TTTCTTTCTTGGAAAGAAAATGG + Intergenic
1069514813 10:69069175-69069197 CTACTTTATAGGAACAAAAATGG + Intergenic
1070945825 10:80390819-80390841 CAGCTTTCTTTTAAGAAAAACGG - Intergenic
1071660370 10:87495897-87495919 CTGATTTATAGGAATAAAAAGGG - Intergenic
1072375022 10:94805709-94805731 CTGCTTTGTTGGTAGAGACAGGG - Intronic
1072571119 10:96658294-96658316 CTGGTTTCCTGGAAGAAAATTGG + Intronic
1073058184 10:100715314-100715336 GGGCCTTCTGGGAAGAAAAAAGG + Intergenic
1073507278 10:104008533-104008555 CAGTTTTCTTGGCAGTAAAATGG - Intronic
1073899119 10:108198717-108198739 CTGCTTTTCTGGAAGAAATCTGG - Intergenic
1073989296 10:109244492-109244514 CCCCTTTTTTGCAAGAAAAATGG + Intergenic
1074364576 10:112847636-112847658 CTTCTTTCTTGGCAGCAAGAAGG - Intergenic
1074990232 10:118699306-118699328 CTGTTTACTTGGAAATAAAAAGG + Intronic
1076359862 10:129880075-129880097 CTGTTCTCTTGGAGGTAAAAGGG - Intronic
1076797597 10:132805749-132805771 CTGCTTTCTGGGGAGAAGACGGG + Intergenic
1077604376 11:3598081-3598103 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1078092706 11:8277280-8277302 CTCCTACCTTGGGAGAAAAACGG + Intergenic
1078470887 11:11585728-11585750 CTGGTTTGATAGAAGAAAAATGG - Intronic
1079386523 11:19984780-19984802 CTGCTGTCAGGGAAGAAAAGAGG + Intronic
1079547128 11:21646050-21646072 TTGCTTCCTTGATAGAAAAAAGG - Intergenic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1080277263 11:30516544-30516566 TTTCTTTATTGCAAGAAAAATGG - Intronic
1080589204 11:33706838-33706860 CTGATTTCTTCAAAGTAAAAAGG + Intronic
1081665824 11:44916586-44916608 CAGTTTTCTTGCCAGAAAAATGG - Intronic
1082672475 11:56052490-56052512 CTGCTGTCTTTGAAGATAGAAGG + Intergenic
1082856918 11:57816524-57816546 CAGGTTTCTTGGGAGAAAAATGG - Exonic
1084226824 11:67720897-67720919 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1084351960 11:68608501-68608523 CTTCTTTGTAGGTAGAAAAATGG + Intronic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1084812503 11:71622571-71622593 CTTCTATGTAGGAAGAAAAAAGG + Intergenic
1084845472 11:71895966-71895988 CTTCTATGTAGGAAGAAAAAAGG + Intronic
1085291724 11:75405057-75405079 CTTCTTTCTGGAAAGAATAAAGG - Intronic
1085853644 11:80151049-80151071 CTGATTTCTTGGAGGAATGATGG - Intergenic
1086541809 11:87921790-87921812 CTGCTATCTGAGAAAAAAAAAGG - Intergenic
1087089650 11:94255414-94255436 GTACTTTTCTGGAAGAAAAAAGG + Intergenic
1087334989 11:96832947-96832969 CTGCACAGTTGGAAGAAAAAAGG - Intergenic
1087500593 11:98948137-98948159 CTGTTTTTTTGGAGGAGAAATGG - Intergenic
1087516007 11:99162091-99162113 TTTCTTTCTAGGAAAAAAAAAGG - Intronic
1087595157 11:100244261-100244283 CTATTTTGTTGGTAGAAAAAGGG - Intronic
1088077131 11:105863861-105863883 CTGGTTTCTAAGAAGAAAATTGG + Intronic
1088095397 11:106094568-106094590 TTGCTTTCCTGAAAGATAAAAGG - Exonic
1088412813 11:109554043-109554065 CTGATTTCTTTAAAGAAAACTGG - Intergenic
1088579925 11:111305400-111305422 CTGCTTTCTGGGAACAGAGAAGG - Intronic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1089022881 11:115235226-115235248 CTGCTTTTCTGAAAAAAAAAGGG + Intronic
1089464112 11:118672985-118673007 CTGCTTTTCTGGAAGTTAAAGGG - Intronic
1090265939 11:125352971-125352993 CTTCTTTCTTGGGAGGCAAAAGG - Intronic
1090273403 11:125403542-125403564 CTCTTTTCTTGGATGTAAAATGG - Intronic
1090657120 11:128854558-128854580 CTGCTTTCTTGGGTGACAACAGG + Intronic
1090763757 11:129859073-129859095 CTGCTTTCTTAAGAGAAAAAGGG - Exonic
1091702342 12:2672240-2672262 CTTCTCTCTTGGAACATAAAAGG + Intronic
1092431529 12:8413232-8413254 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1092434484 12:8435849-8435871 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1092573920 12:9758061-9758083 CTGCTTGTTGGGAAAAAAAAAGG - Intronic
1092759203 12:11794096-11794118 CTGCTTTCTTAGAGGCACAATGG + Intronic
1093104480 12:15069291-15069313 CTCCTATCATGGCAGAAAAATGG + Intergenic
1094029747 12:25997793-25997815 CTCCTTTCTTGGCCAAAAAAAGG - Intronic
1094403725 12:30091685-30091707 CTCCTGTCTTGGAACAAATAGGG - Intergenic
1095425895 12:42074494-42074516 CTGCTTGGTTTGAAGAGAAAGGG + Intergenic
1095852961 12:46831015-46831037 CTGCTGACTTGGAGGAAAAGGGG - Intronic
1096028476 12:48389179-48389201 CTGACCTCTTGGAAGAAAGATGG + Intergenic
1096249212 12:50016712-50016734 TTGATTTCTTGGCAGAAAGATGG - Exonic
1096249965 12:50024781-50024803 ATGCTTTCTTAAAAAAAAAAAGG + Intronic
1096370974 12:51068773-51068795 CTACCTTCTTGAAAAAAAAAGGG + Intronic
1096905850 12:54934749-54934771 CTTTCTTCTTAGAAGAAAAATGG - Intergenic
1097574973 12:61381328-61381350 TTGCTTTCTAGAATGAAAAATGG + Intergenic
1098177790 12:67810963-67810985 CTGCTTTCATGGAGGAAAACAGG + Intergenic
1098515537 12:71372395-71372417 CTGCATTATTGGAATAAAGAAGG - Intronic
1099306606 12:80964476-80964498 CAGCTTTTATGCAAGAAAAATGG - Intronic
1100074071 12:90756773-90756795 TTACTTTGTTGGAAGAAACAAGG + Intergenic
1100555663 12:95691217-95691239 CTTCTTGTTTGGAAGGAAAAAGG + Intronic
1100667698 12:96772421-96772443 CTGCTGGCTTGGAAGATAAAGGG - Intronic
1101298755 12:103455681-103455703 CTGCTCTCTAAGAAGAGAAAAGG - Intronic
1101306983 12:103538246-103538268 CTGCTAGCTGGGAAGAAAAATGG + Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101788595 12:107908518-107908540 CTGCTTTGTTGGGAGAAGCAAGG + Intergenic
1103256244 12:119543820-119543842 TTGCTTTCAAGGGAGAAAAATGG + Intergenic
1106373875 13:29164704-29164726 GTGCTTTCAAGGAAGAAAAATGG + Intronic
1106415526 13:29543217-29543239 CTACTTTCATGGGGGAAAAAAGG + Intronic
1106476572 13:30103702-30103724 CTCCTTTCATGGAAACAAAAGGG + Intergenic
1107101058 13:36593022-36593044 CTGTGATCTTGGAAGAAAAGAGG - Intergenic
1107340493 13:39400130-39400152 CTGCTTTCTTGGATCAAATTTGG - Intronic
1108008481 13:45977434-45977456 CTACTTTCTTCAAAGGAAAATGG + Intronic
1108065850 13:46577029-46577051 CTGCTGGCCTGAAAGAAAAAAGG - Intronic
1108081689 13:46743712-46743734 CTTCTTTCTGGGGAGAAAATGGG + Intronic
1108871569 13:54993341-54993363 ATGCTTTCTTTGAATAAACATGG + Intergenic
1109326564 13:60875213-60875235 CTGATTTCTGAGAATAAAAATGG + Intergenic
1110051484 13:70906702-70906724 TTGATTTCTTGGAATAAATAAGG + Intergenic
1110116936 13:71829705-71829727 CTGCTCTCCGGGAAGCAAAATGG - Intronic
1110321890 13:74169984-74170006 TTGCTTTCTAGAAAAAAAAATGG - Intergenic
1111429013 13:88127681-88127703 CTTCATTCTTGAAAGAGAAAAGG - Intergenic
1112235103 13:97628902-97628924 CTGTTTGCTTGGAAGAAGATGGG + Intergenic
1114814788 14:25944288-25944310 CTGCTTTCTTGTCATCAAAATGG + Intergenic
1116206491 14:41874095-41874117 CTGCTATATTGGAAGAAACAGGG + Intronic
1117039787 14:51759521-51759543 CTTCTATGTAGGAAGAAAAAAGG + Intergenic
1118943097 14:70356485-70356507 CTGCTTTCTAGCAACACAAATGG + Intronic
1119270926 14:73303787-73303809 CGGTTTTCTTTGAAAAAAAAAGG - Intronic
1119513591 14:75230639-75230661 CTGCTTCCTTGTAGGCAAAATGG - Intergenic
1119542537 14:75450241-75450263 CTGCTTTCTGGGAAGAGGCAGGG - Intronic
1120852746 14:89186161-89186183 CTGCTTACTTGGAAGCACACTGG + Intronic
1121931948 14:97980174-97980196 ATGCTTTCCTGGAGCAAAAAGGG + Intergenic
1123119518 14:105910246-105910268 CTGCATTTCTGGAAGAACAAGGG - Intergenic
1124393739 15:29282711-29282733 CTGTTTGCTTGGAAGAAGACAGG + Intronic
1124452840 15:29812442-29812464 TTGTTTTCTTGGAAGAAGACAGG - Intronic
1125332291 15:38594094-38594116 CTGCTTTCTCTAAAGAGAAAAGG + Intergenic
1125389465 15:39176012-39176034 CTGCTTTTTTGGTTGGAAAAGGG + Intergenic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1127401621 15:58592574-58592596 CTGGTTCCCTTGAAGAAAAATGG + Exonic
1128225378 15:65997950-65997972 GTGCTTTCTAGGAAGAAGAAAGG + Intronic
1129633932 15:77294021-77294043 CTGCATTCATGGAAGGAAAAAGG + Intronic
1130545530 15:84855496-84855518 ATGATATCTTGGAGGAAAAAAGG + Intronic
1130583106 15:85155954-85155976 CTTCTTTCTTTGAAGAAGATGGG - Intergenic
1131936828 15:97515511-97515533 CTCCTTCTTTTGAAGAAAAAGGG + Intergenic
1132277735 15:100583605-100583627 ACCCTTTCTTGGAATAAAAAAGG - Intronic
1134002760 16:10795421-10795443 TTGCATTTTTGGAAGAAATAGGG + Intronic
1134142697 16:11735449-11735471 TTCCTTTTTAGGAAGAAAAAGGG + Intronic
1134475788 16:14572479-14572501 TTGCTTTCTATGGAGAAAAAGGG + Intronic
1134683489 16:16142743-16142765 CTGTGTTCCTGGAAGAAAACAGG + Exonic
1135573579 16:23567811-23567833 CTGCCTCCTTGGATGAACAATGG - Intronic
1136629451 16:31481005-31481027 CTGATGCCTTGGAAGAAAGAAGG + Intergenic
1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG + Intronic
1137719221 16:50618168-50618190 CTGCTCATTTGGAAGAAAAAAGG - Intronic
1137724634 16:50648821-50648843 CTGCTTTCCAGGCAGCAAAATGG - Intergenic
1140624005 16:76770250-76770272 CTGCTCTCTTGGGAGAACAGGGG - Intergenic
1140650776 16:77085661-77085683 CTTCTCTCTTGGAAGGATAAAGG - Intergenic
1141149340 16:81553229-81553251 CTGCTTTTCTGGAAGATGAAGGG + Intronic
1142707597 17:1706331-1706353 AGGCTTTCATGGAAGAACAAGGG - Exonic
1142844900 17:2666041-2666063 CTGGTCTTTTGGAAAAAAAATGG + Exonic
1144347738 17:14365226-14365248 ATGCTCTCTGGGAAGAAAAACGG + Intergenic
1145997395 17:29112512-29112534 CTGCTCTCCTGGAAGAACACTGG + Intronic
1147405930 17:40212151-40212173 TTGCATTCTTGGAAAAAAACAGG - Intergenic
1148109897 17:45138414-45138436 CTGCTTGCTCAGAGGAAAAAAGG - Intronic
1148469322 17:47883721-47883743 CTGCTTTCCTGGATCAAAATGGG - Intergenic
1148726069 17:49791059-49791081 CTGCCTTTTTGGAAGATAGATGG + Intronic
1149575043 17:57705893-57705915 GAGGTTTCTGGGAAGAAAAAGGG + Intergenic
1149889260 17:60371744-60371766 CTCCTTTCATGTAAGTAAAAAGG + Intronic
1151094735 17:71483695-71483717 AAGCTTTCTAGGAAGAAAGATGG - Intergenic
1154036672 18:10809979-10810001 CTGCTTATTTGGAAATAAAAAGG + Intronic
1154934747 18:21041503-21041525 CTGCATTTTTGAAAGAAAAATGG - Intronic
1155560155 18:27067067-27067089 CTACTTTCTTGAAAGTAAAATGG + Intronic
1155946057 18:31852657-31852679 TTGGTATCTAGGAAGAAAAAGGG + Exonic
1156693600 18:39738842-39738864 GAGCTTTCATGGAAGAAAAAGGG - Intergenic
1157430016 18:47616994-47617016 TTACTTTCTTATAAGAAAAATGG + Intergenic
1157452279 18:47797862-47797884 ATGCTTTCTAGGAAGACAATAGG + Intergenic
1158014750 18:52771053-52771075 CTGCTTTCTGAAAAGAAAAGCGG - Intronic
1159802876 18:72922741-72922763 CTGATTTTTTATAAGAAAAATGG + Intergenic
1159938688 18:74388992-74389014 CTGCTTTCCTGGCAGAGAAATGG - Intergenic
1160124052 18:76154428-76154450 CTGCTTTCTTCTAAGACAAACGG + Intergenic
1162556060 19:11386520-11386542 CTGCTTTCATGGAATAGTAAGGG - Intronic
1163274802 19:16276861-16276883 ATGTTTTTTTGAAAGAAAAAAGG - Intergenic
1167959896 19:53097137-53097159 CTGTTATCTTGGAATAAACAGGG + Intronic
1167963695 19:53126978-53127000 CTGTTATCTTGGAATAAACAGGG + Intronic
1168373671 19:55857804-55857826 CAGCTTCCTTGGGAGCAAAAAGG - Exonic
925155724 2:1647915-1647937 CTCCTCTCTTGGAACAAAACAGG + Intronic
925424780 2:3739766-3739788 CTGCCTTGTTGCAAGAACAAAGG - Intronic
925648576 2:6064230-6064252 GAGGTCTCTTGGAAGAAAAAAGG + Intergenic
926278846 2:11427848-11427870 TTTCTTTTTTTGAAGAAAAATGG + Intergenic
927077128 2:19589818-19589840 CATCTTTCATAGAAGAAAAATGG - Intergenic
928656499 2:33457387-33457409 ATGCTTTATTGTAATAAAAATGG + Intronic
929050724 2:37834499-37834521 CTGTTTTGATGGCAGAAAAAAGG + Intergenic
929652542 2:43695680-43695702 CTGTTTTCTTGAAAGAACACAGG + Intronic
929846222 2:45531128-45531150 CTGCTTTCCTTGAAAAGAAAAGG + Intronic
929966051 2:46537513-46537535 CTTCTTTCCTGGAAGCAAAATGG - Intronic
930692090 2:54374726-54374748 CTTTTTTCTTGGAAAAATAAAGG + Intronic
932948075 2:76261147-76261169 CTTTTTTCTTGAAAAAAAAAAGG + Intergenic
933510482 2:83234788-83234810 TAGTTTTCCTGGAAGAAAAATGG + Intergenic
933933876 2:87183912-87183934 CTCCGTACTTGGAAGAACAAAGG - Intergenic
934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
934792485 2:97073439-97073461 GAGTTTTCTTGGAAGAAAGAAGG + Intergenic
934814130 2:97310265-97310287 GAGTTTTCTTGGAAGAAAGAAGG - Intergenic
934823565 2:97398216-97398238 GAGTTTTCTTGGAAGAAAGAAGG + Intergenic
935189076 2:100761397-100761419 CTGCATTCTAGGCAGAAAGAAGG + Intergenic
936359231 2:111781533-111781555 CTCCGTACTTGGAAGAACAAAGG + Intronic
936870968 2:117133774-117133796 CAGCTTTTTTGGAAGTAAAGCGG - Intergenic
938175116 2:129118624-129118646 CAGCTATGTAGGAAGAAAAAAGG - Intergenic
939338697 2:140865218-140865240 ATGCTTACTTGTAAGAAAACTGG + Intronic
939456372 2:142442260-142442282 CTGCCTTCTATGAAGAAACAGGG + Intergenic
939680490 2:145125520-145125542 CTACTCTCTTGGAAGATATATGG - Intergenic
939910934 2:147982136-147982158 CTTCTTTCTTAGAAGAAAAGTGG + Intronic
939989644 2:148865185-148865207 CAGCTCTCCTGGAAGAGAAAGGG + Intergenic
940047523 2:149425062-149425084 CAGCTTATCTGGAAGAAAAAAGG - Intronic
940164005 2:150747777-150747799 CTGCTTTTTTGGAAGAATATGGG - Intergenic
940222805 2:151371107-151371129 ATGCTTTGTAGGAAGAAGAAAGG - Intronic
940678729 2:156756881-156756903 TTGCTTTCTTGTAAGCAAATGGG - Intergenic
941409014 2:165129640-165129662 TTACTTTCTTTGAAGAAGAAAGG + Intronic
941469272 2:165864224-165864246 ATGCTTTCATAGAAGAGAAAAGG + Intronic
941567917 2:167131506-167131528 TTGCTTCCTTGGAAGTACAAAGG - Intronic
941680306 2:168391121-168391143 GTGTTTTCTTTGAAGAAAGAAGG + Intergenic
942974690 2:182001462-182001484 CTGCTTTCTTCTAAGAATATAGG + Intronic
943446173 2:187990642-187990664 CTTCTATCTTGGAATAAAAGAGG - Intergenic
943989443 2:194668854-194668876 TTGCTTTTTTGGAAAAAGAATGG - Intergenic
944237324 2:197452370-197452392 CTGATTACTTGGGAGAAAATGGG - Intergenic
944537891 2:200729208-200729230 CTGCCCTCTTGGAAGAACAGAGG + Intergenic
945021563 2:205577994-205578016 CTGCTTTGTTGGAGTAAATATGG + Intronic
945102808 2:206277642-206277664 CTGCTTTAGAGGAACAAAAATGG + Intronic
945436770 2:209827797-209827819 TCTGTTTCTTGGAAGAAAAAAGG - Intronic
945728757 2:213506885-213506907 CTTCTTTCATGGTAGCAAAATGG + Intronic
946114265 2:217447815-217447837 CTGCATTCTACAAAGAAAAATGG + Intronic
946155132 2:217802155-217802177 CTCCTATCTTGGAAGATAATTGG + Exonic
946851812 2:223914835-223914857 CTGCTTTAGCTGAAGAAAAATGG - Intronic
946855667 2:223947558-223947580 CTGCTTTCAGGGAAGAACAGTGG + Intergenic
947062983 2:226187679-226187701 CTTCCTGCTTGGAAAAAAAAAGG - Intergenic
947195279 2:227558725-227558747 CATCTTTCATGAAAGAAAAAAGG + Intronic
947288809 2:228547990-228548012 CTGTTTACTTAGAAGAATAAAGG + Intergenic
947820005 2:233062931-233062953 CTGCTTTCTTTCAAGAAATGAGG - Intronic
947844302 2:233231851-233231873 CTGCTTTCCTGGAAAATAAGTGG - Intronic
947983502 2:234429269-234429291 CTGCTGACTTGGAGGAGAAAGGG - Intergenic
1169744372 20:8928579-8928601 CTGGTTACTTGGAAGAAAGAGGG - Intronic
1170662027 20:18351322-18351344 CTGTCTTCTGGGAAGAACAATGG + Intergenic
1170695676 20:18656143-18656165 CTGTTTTCTTTGTAGGAAAATGG + Intronic
1171517541 20:25750096-25750118 CTGCTTTATTGGAAGGACAGAGG + Intergenic
1172609364 20:36238444-36238466 CTGCTTTATTTAAAGTAAAAAGG + Intronic
1173450752 20:43161720-43161742 TTGCTTTTTTGCAGGAAAAATGG - Intronic
1173877266 20:46381847-46381869 TTGCTTTAGTGGAAGAGAAAAGG - Intronic
1174309133 20:49636827-49636849 CTGTTTTCATGGGAGTAAAATGG - Intronic
1175272964 20:57747948-57747970 CTGCTCTCTTGGTTCAAAAAAGG + Intergenic
1175614114 20:60378052-60378074 CTGCATTCATAGAAGAAAGAGGG - Intergenic
1177287201 21:19066869-19066891 CTCCTTTTTTTGAAGCAAAAGGG - Intergenic
1177498558 21:21919954-21919976 CTGGTTTCTTGGAAAAAAATAGG - Intergenic
1179489401 21:41730410-41730432 CAGCTTTCATGGAGGAGAAAAGG - Intergenic
1179728407 21:43353758-43353780 CTCCTCTCTGGGGAGAAAAAGGG - Intergenic
1180008929 21:45037061-45037083 GTGCTTTCCAGGAAGACAAAAGG - Intergenic
1180540311 22:16440229-16440251 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1183004859 22:34892611-34892633 TTGTTTTTTTGGAAGACAAAAGG - Intergenic
1183815412 22:40296079-40296101 CTGCTTTGTTGGTAGTAAAGAGG - Intronic
1184591687 22:45488413-45488435 TAGCTTTCTTGGGAGAAATAGGG - Intergenic
1184881299 22:47306046-47306068 CAGCTTTCTGAGAAGAAAATGGG - Intergenic
949500608 3:4676886-4676908 AGGCTTTCTGGGAAGAAAATGGG + Intronic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
950467133 3:13162237-13162259 CTGCCTTCTTGGAAGACAGAGGG + Intergenic
950772082 3:15320017-15320039 TGGCTTTATTGGAAGAAGAAAGG - Intronic
951022876 3:17799640-17799662 CTTCTCTCGTGGAAGGAAAATGG + Intronic
951038113 3:17955947-17955969 ATGTTTTCATGTAAGAAAAAAGG - Intronic
952408198 3:33024436-33024458 CTGCTTTTTTGGAAAATCAAAGG + Intronic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
953375298 3:42423116-42423138 GAGCTTTCTTGGGAGAAAAAGGG + Intergenic
954824820 3:53363432-53363454 GTGATTTCTTGGAAGCCAAAGGG - Intergenic
955526519 3:59825960-59825982 CTGCTTTCTTGCTAAAAATAAGG + Intronic
955797347 3:62651370-62651392 TTGATTTGTAGGAAGAAAAATGG + Intronic
956285349 3:67603029-67603051 CTGCTTTCTAGGAATAACAGTGG - Intronic
958040615 3:88221902-88221924 ATTCTTTGTTGGAAGAACAAAGG + Intergenic
958072713 3:88635390-88635412 CTGTTTTTTTAGAAGAAATAAGG - Intergenic
958915524 3:100045981-100046003 CTGCATTCTTGGTGGAAAAATGG + Intronic
959360793 3:105388894-105388916 AGGCTTTCATGAAAGAAAAATGG + Intronic
959596636 3:108136189-108136211 CTCTTTTCTTGGGAGAAAGATGG + Intergenic
960535378 3:118809483-118809505 ATCCTTACTTGGAAGAAAGAGGG + Intergenic
960625284 3:119676388-119676410 CTACTATCTGGGAAGACAAAAGG + Intronic
961078140 3:124000760-124000782 CTGCTTTCTTGGCAGCAGGAAGG + Intergenic
961305378 3:125956016-125956038 CTGCTTTCTTGGCAGCAGGAAGG - Intergenic
961418985 3:126784695-126784717 CTCAGTTCATGGAAGAAAAAAGG + Intronic
964367969 3:155969923-155969945 CTGCTGGCTTGGAAAATAAAGGG - Intergenic
965721977 3:171672063-171672085 CTGCTTGCTCAGAAGACAAAAGG - Intronic
966089440 3:176114823-176114845 CTGCTTTCTTGGTGGAAAAGTGG + Intergenic
967491679 3:190099026-190099048 GTGCTTTTTTTTAAGAAAAAGGG + Intronic
967653213 3:192012515-192012537 CTGCATACTTGGAAGAAGACAGG + Intergenic
968170249 3:196503991-196504013 TTGGTTTCTGGGTAGAAAAAGGG + Intergenic
968987875 4:3887745-3887767 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
969023514 4:4154928-4154950 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
969195647 4:5561736-5561758 CAGCTTCCTTGGCAGTAAAATGG + Intronic
969208601 4:5668692-5668714 TTGCCTTCTTTGAAGATAAAGGG - Intronic
969789901 4:9486265-9486287 CTTCTATGTAGGAAGAAAAAAGG + Intergenic
970024451 4:11607715-11607737 CTCCTATCTTGGAACAAAAAAGG + Intergenic
970642111 4:18078393-18078415 CTTTTTCCTTGCAAGAAAAATGG + Intergenic
971085397 4:23269069-23269091 TTTCTTTCATGGAAAAAAAAGGG + Intergenic
971769612 4:30879272-30879294 CTTGTTTATTGGAGGAAAAAAGG - Intronic
971941134 4:33217093-33217115 GTGCTTTCCTTGAAGACAAAGGG - Intergenic
972302970 4:37803259-37803281 CTCCTTTCTTGGAAGATTTAAGG - Intergenic
972384229 4:38548661-38548683 CTGTTTTATTGGAAGAGAATTGG + Intergenic
972591925 4:40496077-40496099 CTGCTTTCCTCTGAGAAAAAAGG + Intronic
974095359 4:57357837-57357859 CTGCTTTCTGAGAAGGAAATGGG - Intergenic
974405150 4:61458022-61458044 CTGGTATCTTTGAAGCAAAAAGG - Intronic
974549383 4:63350672-63350694 CTACTTTCTTCGAGGAAAGAGGG + Intergenic
974892661 4:67900354-67900376 CTGCCTACTTGGAAGCAGAAGGG + Intergenic
976015186 4:80543717-80543739 CTGCATTCCTGCAAGAGAAAAGG + Intronic
976387868 4:84481747-84481769 CAGCTTTCTCGCAAGGAAAAAGG + Intergenic
976947931 4:90793111-90793133 TTACTTTCTTGGTAGAAAAAAGG - Intronic
977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG + Intronic
978889618 4:113808613-113808635 CTGCTTTTAGGGAAAAAAAAGGG - Intergenic
979768190 4:124488953-124488975 CTGCTTTCTCTGAACAAACATGG + Intergenic
979989782 4:127362132-127362154 CTGTTTTCTTGAAATAAAAAGGG - Intergenic
981679334 4:147377094-147377116 CTCTTTTCTCTGAAGAAAAATGG - Intergenic
982151624 4:152464874-152464896 TAACTTTATTGGAAGAAAAAGGG + Intronic
982423722 4:155230313-155230335 CTGATTTTTTTAAAGAAAAAAGG - Intergenic
982465678 4:155727977-155727999 CTGCTTTCCAGGAAGGAAAATGG + Intronic
983174371 4:164570930-164570952 CTGCTTTATTTCAAGAAAAGCGG - Intergenic
983378628 4:166962040-166962062 CTGCCTTCTTTGAAGAAGGAAGG - Intronic
983980232 4:173986793-173986815 CTGGTTTCTAGAAAGAAAGAAGG + Intergenic
984985291 4:185323133-185323155 CTTCTTTCTGGGATGAGAAATGG + Intronic
985077335 4:186229014-186229036 CTTTTTTCCTGGAAAAAAAAAGG - Intronic
985180614 4:187257429-187257451 CTGTTTTCTAAGGAGAAAAAAGG + Intergenic
985426894 4:189839985-189840007 CTGCTTCCCTGAAAGAAATACGG + Intergenic
986382501 5:7200720-7200742 CTTCTTTCTTGGGAGATTAAGGG + Intergenic
987183295 5:15388163-15388185 CTTCTTTCTTGTAAAACAAAGGG - Intergenic
988204101 5:28112116-28112138 CTGCTCTCTTAAAAGTAAAATGG - Intergenic
988535907 5:32068218-32068240 CTGATATCTTGGAAGAAACCAGG - Intronic
988943773 5:36173633-36173655 GTTCTTTCTTGGAGGAACAAAGG - Intronic
990178175 5:53130396-53130418 TTGCTTTCTGGAAAGAAAGAAGG + Intergenic
990659285 5:57995242-57995264 CTGCAGACTTGTAAGAAAAATGG + Intergenic
990718200 5:58662553-58662575 CTGCTTTCTTAGCTGATAAATGG - Intronic
991319419 5:65353258-65353280 CTGCTGTATAGGAAGCAAAAAGG + Intronic
991455000 5:66793485-66793507 CTGCTTTCTGGCAAGAAAGATGG + Intronic
992089116 5:73302325-73302347 CTGCTCTCTTGCAAACAAAAGGG + Intergenic
992578254 5:78142866-78142888 CTGATTTCTGGAAAGAAAAGAGG + Intronic
993252450 5:85546868-85546890 CTGAATTTTTGGAAGAATAATGG - Intergenic
993307725 5:86291711-86291733 CTGCTTTTTTTGAAATAAAAGGG + Intergenic
993368808 5:87066555-87066577 CTGCTTTCTAGAAAGTAAAAAGG - Intergenic
994491851 5:100457875-100457897 CTACTGTCTTGGAAGAAATAAGG + Intergenic
994752018 5:103749950-103749972 CTTCTTTCTCAGAAAAAAAATGG - Intergenic
994930476 5:106176567-106176589 CTGCCTTTTTTGAAAAAAAATGG - Intergenic
995215020 5:109585216-109585238 CTGCTTCCTTTGAAGAAATGTGG + Intergenic
995967553 5:117927302-117927324 CTGCTTTCATTGCATAAAAAAGG - Intergenic
996140130 5:119896963-119896985 CTGCTGTCTTTGAAGACAGAAGG - Intergenic
996332950 5:122351897-122351919 CTGCTTTTTTGGAAAACAAGAGG - Intronic
996679012 5:126209820-126209842 TAGCTTTCTTGAAAGAATAAAGG + Intergenic
996775845 5:127131378-127131400 GTGCATTCTTGGCAGAAAGAAGG - Intergenic
998194023 5:140051035-140051057 CTGCTTTATTTAAAAAAAAAAGG + Intergenic
998945905 5:147339130-147339152 CTGATTCCTGGGAGGAAAAATGG + Intronic
999044201 5:148449792-148449814 CTACCTTCATGGAAGAAATAAGG + Intergenic
999597807 5:153224409-153224431 CTGATTTCTTGAAATAGAAAAGG + Intergenic
999665560 5:153909475-153909497 CTGCCTTTTTGGAAGATGAAAGG - Intergenic
1000044102 5:157507406-157507428 CTGATTCCTTGGAAGGAAATGGG + Intronic
1000227489 5:159279672-159279694 CTGTTGACTTGGAAGAAAAGTGG + Intronic
1000898508 5:166885525-166885547 CTTCTTTCATAGAAGACAAATGG - Intergenic
1001149147 5:169211604-169211626 ATGTTTTCTAGGAATAAAAAAGG - Intronic
1003329584 6:5118860-5118882 CTGGATTCTAGAAAGAAAAAAGG - Intronic
1004031591 6:11875454-11875476 CTGCTTTCTAGGTGGAAAGAGGG - Intergenic
1006150349 6:31983698-31983720 CTGCTTTCCTGAAGGAAATAAGG + Intronic
1006156650 6:32016436-32016458 CTGCTTTCCTGAAGGAAATAAGG + Intronic
1006284712 6:33083773-33083795 CTGCTTTCTGAGGAGGAAAAAGG + Intronic
1007747629 6:44052734-44052756 CTGCTTTCTGGGAATAAGAAGGG + Intergenic
1007837126 6:44682370-44682392 CTGGTTTCCTAGAAAAAAAAGGG + Intergenic
1008230259 6:48978557-48978579 CTGCCATCTTGGAAAAAAAATGG - Intergenic
1009651271 6:66480364-66480386 CTGCCTTCCTGGAAGCCAAATGG - Intergenic
1009815265 6:68725180-68725202 CTGGTTTGTTGGAGGAACAATGG + Intronic
1011420461 6:87166400-87166422 ATGCTTTCTTTGAAAAAATAAGG + Intronic
1011421812 6:87181140-87181162 CTGCTTTATTGCAAGGAAGAGGG + Intronic
1012067842 6:94573233-94573255 TTGCATTCTTGGAAGGTAAAGGG - Intergenic
1013533371 6:111040683-111040705 CTGATTTATTGGTAGAAATAGGG - Intergenic
1013617506 6:111858536-111858558 AGGCTTTGTTAGAAGAAAAATGG - Intronic
1013839107 6:114368983-114369005 CTTTTTTTTTGGAAAAAAAAAGG - Intergenic
1014188528 6:118463960-118463982 CTGTTTTCTTGCCAGATAAAGGG - Exonic
1016806961 6:148221234-148221256 CTGATTTATTTGAAGAAAATAGG - Intergenic
1016821033 6:148346595-148346617 TGGCTTTGTTGAAAGAAAAAGGG + Intronic
1017240340 6:152161482-152161504 ATGCTTTTTTTAAAGAAAAATGG + Intronic
1018763710 6:166912593-166912615 CTGCTCTCTGGGAAGAACTATGG + Intronic
1020310619 7:6865097-6865119 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1020434695 7:8150474-8150496 CTGCTTTCCTGACAGGAAAATGG + Intronic
1020954661 7:14726041-14726063 CTGTTTTCTTAGATGTAAAATGG - Intronic
1022904379 7:34841573-34841595 CTCCTTTATTGGGAGATAAAAGG - Intronic
1023675683 7:42627546-42627568 CTGCCTTCTTGGAAGGAAAGTGG + Intergenic
1024312542 7:47982262-47982284 ATCTTTTCTTGGAAGAAGAAAGG + Intergenic
1024800214 7:53068506-53068528 TTGCTTTCTAGTAAGAAAAATGG + Intergenic
1026626991 7:72003356-72003378 TTGCTTTCATGGATGAAAACAGG + Intronic
1026969810 7:74461037-74461059 CAGTTTTCTTGGATGTAAAAGGG + Intronic
1027458928 7:78428034-78428056 CTGTTTTCTGGGAATAAAAGGGG - Intronic
1028539999 7:91932415-91932437 CTGGTTTCTTGGATGAAGGATGG + Intergenic
1030377689 7:108772542-108772564 ATGCTTTCTTGGAGGAAAAAAGG - Intergenic
1031357252 7:120801882-120801904 CTTATTTCCTGGAAAAAAAATGG + Intronic
1031680814 7:124672292-124672314 CTGCTTTGTTGAGAGAAAAGGGG - Intergenic
1032990804 7:137393223-137393245 CTGCTTTTTTTAAAAAAAAATGG - Intronic
1035699043 8:1624199-1624221 CTGTTGTATTGGAAGAAAATTGG + Intronic
1036787032 8:11694749-11694771 CTGTGATCATGGAAGAAAAATGG - Intronic
1036832490 8:12032061-12032083 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1036902662 8:12682586-12682608 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1036934134 8:12984535-12984557 CTTCTTTCCTGGGAGAAAAGAGG + Intronic
1037011474 8:13848584-13848606 TTGCTTTCTTGAAATGAAAATGG - Intergenic
1037161468 8:15778590-15778612 CTGCCTACTTGGAAGAGAAAGGG - Intergenic
1037392037 8:18403389-18403411 ATCCTTTCTGGGAAGAAACACGG + Intergenic
1038180406 8:25222085-25222107 CTGTTTTCTGTGAAGGAAAAAGG + Intronic
1038701559 8:29854264-29854286 CTTCTTTCTTGGAATTCAAATGG + Intergenic
1039200281 8:35083578-35083600 CTGCTTTAAAGGAAGAAGAATGG + Intergenic
1040395097 8:46991159-46991181 CTGCTTTCTTTGAAAAAACAAGG - Intergenic
1042445121 8:68875259-68875281 CTGCTTTAATGGGAAAAAAATGG + Intergenic
1042766516 8:72328042-72328064 CTGTTTTCTTCTTAGAAAAATGG - Intergenic
1044256544 8:90069979-90070001 TTTTTTTTTTGGAAGAAAAAAGG + Intronic
1044466989 8:92518714-92518736 CTGCTTTATTGAAAGATAACTGG - Intergenic
1044743834 8:95353475-95353497 CTGCTTTCTTGCAATTAAAAGGG - Intergenic
1045104223 8:98875635-98875657 CTTCTTTGTTGGAAGAGACATGG + Intronic
1045898576 8:107247103-107247125 TTGCTTTCTTGAAAGAATACAGG + Intergenic
1045979034 8:108162398-108162420 CTGTTTACTGGGAAGAACAAAGG - Intergenic
1046073798 8:109291710-109291732 CTACAATCTTGGGAGAAAAAAGG + Intronic
1046285659 8:112090235-112090257 CAGGGTTCTTGGAAGAATAATGG + Intergenic
1047721016 8:127639427-127639449 CTGCTTTGTTAAAACAAAAAAGG + Intergenic
1048724339 8:137365037-137365059 TTGCTTTCATGAAAAAAAAATGG + Intergenic
1049026317 8:139991813-139991835 CTGCTCTCTTTGCTGAAAAAGGG - Intronic
1050168754 9:2793604-2793626 CTACCTTCTTGTATGAAAAAAGG + Intronic
1050655742 9:7826843-7826865 CTGCTTTCTAATATGAAAAAAGG - Intronic
1051292922 9:15563461-15563483 TGGTTTTCTTGGTAGAAAAATGG + Intronic
1051681324 9:19610936-19610958 CTGCTCTGTTGGAGGAATAAGGG + Intronic
1052104912 9:24501663-24501685 CTGATTTCCTGAAAAAAAAATGG + Intergenic
1052992093 9:34524394-34524416 ATGCTATCTTGAAAGAAGAAAGG + Intergenic
1053942038 9:43260807-43260829 CTGTTTTTATGAAAGAAAAAAGG - Intergenic
1055143198 9:72899977-72899999 CTGCTAATTTGGAAAAAAAAAGG + Intergenic
1056027637 9:82515935-82515957 CTGCTTTGTTGGAATATTAATGG + Intergenic
1056294511 9:85178983-85179005 CTGCTTTGATGGCAGAGAAAAGG - Intergenic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1058121082 9:101139668-101139690 ATGCTTACCTGGAAGTAAAATGG - Intronic
1058886495 9:109325470-109325492 CTGCTCTATGGGAAAAAAAATGG - Intergenic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1059434004 9:114265672-114265694 CTGTTTTCTTGCCAGGAAAATGG + Intronic
1059615285 9:115944217-115944239 CTGCTTGCTCGGAACCAAAATGG - Intergenic
1060287931 9:122271050-122271072 TGGCTTTCTTGGTAGCAAAATGG - Exonic
1185828470 X:3275773-3275795 CTGCTTTCTTGGGAAAAACTTGG - Intronic
1189070085 X:37854411-37854433 CTTCTTACTGGGAAGAAATAGGG - Intronic
1189897231 X:45668213-45668235 CTCCTTTCTTGAAGGAAAATAGG + Intergenic
1189958644 X:46304064-46304086 CTGCTGTGATGGAAGTAAAATGG + Intergenic
1190129954 X:47738741-47738763 CTGATGTCTTGGAAGAAATTTGG - Intergenic
1191633352 X:63349713-63349735 TTGTTTTCTGGGAAGAAACAAGG + Exonic
1192047609 X:67692743-67692765 CTTCTTTTGTGGATGAAAAATGG + Intronic
1192373748 X:70538105-70538127 CTGCTTTGTTCTAAGAAGAAGGG + Intronic
1193027494 X:76860225-76860247 CTTCTTTCTTGGATTACAAATGG - Intergenic
1193640881 X:84008548-84008570 CTGCTTTCTCGTAAGGAACAGGG + Intergenic
1193748135 X:85309023-85309045 CTTATTTCTTTAAAGAAAAATGG + Intronic
1195067574 X:101251385-101251407 CTACTCTCTAGAAAGAAAAAAGG + Intronic
1196193531 X:112818036-112818058 CTGCTTTGTGGGCAGAAAAGAGG + Intronic
1196230919 X:113220129-113220151 AGGCTTTCTTGGCTGAAAAAAGG - Intergenic
1196271583 X:113718089-113718111 CAGTTTTCTTAGAAGAATAAAGG + Intergenic
1196700308 X:118660786-118660808 CTACTTTATTTGAACAAAAATGG + Intronic
1196902960 X:120403723-120403745 CTGATTTCTTGAAAGAACCAGGG + Intergenic
1197141041 X:123117576-123117598 TGGCTTTCTTGGTAGCAAAATGG + Intergenic
1198634886 X:138686090-138686112 CTGCTAACTTTTAAGAAAAAAGG + Intronic
1198791942 X:140355473-140355495 GAGCTTTCTTGGCAGAAGAAGGG - Intergenic
1200632220 Y:5603146-5603168 CTGCTTTTTTACAAGAAGAAGGG - Intronic
1200825971 Y:7641538-7641560 TTGTTTTTTTGGAAAAAAAAGGG + Intergenic
1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1202152654 Y:21857251-21857273 GTCTTTTCTTGGGAGAAAAATGG - Intergenic