ID: 1064338591

View in Genome Browser
Species Human (GRCh38)
Location 10:14466873-14466895
Sequence ACAAATGTAATGTTCCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064338591_1064338593 -8 Left 1064338591 10:14466873-14466895 CCCTGCAGGAACATTACATTTGT No data
Right 1064338593 10:14466888-14466910 ACATTTGTGATAGCTCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064338591 Original CRISPR ACAAATGTAATGTTCCTGCA GGG (reversed) Intergenic
No off target data available for this crispr