ID: 1064340150

View in Genome Browser
Species Human (GRCh38)
Location 10:14478255-14478277
Sequence TGCCAGTTATTGACCCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064340146_1064340150 5 Left 1064340146 10:14478227-14478249 CCTGTGTCCCTGGACTGATTTCT No data
Right 1064340150 10:14478255-14478277 TGCCAGTTATTGACCCTTGGTGG No data
1064340148_1064340150 -3 Left 1064340148 10:14478235-14478257 CCTGGACTGATTTCTTTTCTTGC No data
Right 1064340150 10:14478255-14478277 TGCCAGTTATTGACCCTTGGTGG No data
1064340147_1064340150 -2 Left 1064340147 10:14478234-14478256 CCCTGGACTGATTTCTTTTCTTG No data
Right 1064340150 10:14478255-14478277 TGCCAGTTATTGACCCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064340150 Original CRISPR TGCCAGTTATTGACCCTTGG TGG Intergenic
No off target data available for this crispr