ID: 1064340409

View in Genome Browser
Species Human (GRCh38)
Location 10:14480463-14480485
Sequence AGCTACCCAATAGGGGAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064340403_1064340409 9 Left 1064340403 10:14480431-14480453 CCCAGAAGCTAGGTAATTAGCCA No data
Right 1064340409 10:14480463-14480485 AGCTACCCAATAGGGGAACTCGG No data
1064340404_1064340409 8 Left 1064340404 10:14480432-14480454 CCAGAAGCTAGGTAATTAGCCAA No data
Right 1064340409 10:14480463-14480485 AGCTACCCAATAGGGGAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064340409 Original CRISPR AGCTACCCAATAGGGGAACT CGG Intergenic
No off target data available for this crispr