ID: 1064344502

View in Genome Browser
Species Human (GRCh38)
Location 10:14519238-14519260
Sequence CCCCTGTGAATACGATCAAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064344497_1064344502 0 Left 1064344497 10:14519215-14519237 CCTTCTAAAGGAGCCTACCAGGG 0: 1
1: 0
2: 2
3: 7
4: 56
Right 1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG 0: 1
1: 0
2: 1
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064344502 Original CRISPR CCCCTGTGAATACGATCAAG TGG Exonic