ID: 1064344502

View in Genome Browser
Species Human (GRCh38)
Location 10:14519238-14519260
Sequence CCCCTGTGAATACGATCAAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064344497_1064344502 0 Left 1064344497 10:14519215-14519237 CCTTCTAAAGGAGCCTACCAGGG 0: 1
1: 0
2: 2
3: 7
4: 56
Right 1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG 0: 1
1: 0
2: 1
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064344502 Original CRISPR CCCCTGTGAATACGATCAAG TGG Exonic
914211403 1:145582701-145582723 CACCTGTGAATAAGAACATGCGG + Intergenic
918145960 1:181756058-181756080 CCCCTGTGGAGACGGTGAAGAGG - Exonic
918827998 1:189352198-189352220 CTCCTGTGAATAGGAACAAGTGG + Intergenic
923021991 1:230172221-230172243 CCCCAGTGAATATGAGGAAGAGG - Intronic
924555080 1:245111549-245111571 GCACTGCGAATACGTTCAAGAGG - Intronic
924847218 1:247785735-247785757 GCCCTGTGATTAAGATCAATGGG - Intergenic
1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG + Exonic
1071673679 10:87635579-87635601 GCCCTGTGATTAAGATCAATGGG - Intergenic
1079713102 11:23710445-23710467 CCCTTGTGTATATGATCAATTGG - Intergenic
1093036597 12:14337505-14337527 GCCCTGTGATTAAGATCAATTGG + Intergenic
1098581326 12:72102728-72102750 CCCCTGTGAAGATGAACATGAGG + Intronic
1104358730 12:128112240-128112262 TCCCTGTGTATATGATCTAGTGG - Intergenic
1106140148 13:27005201-27005223 CCACTGAGATTACGATAAAGGGG + Intergenic
1108914064 13:55587081-55587103 GCCCTGTGATTAAGTTCAAGGGG - Intergenic
1114905146 14:27118730-27118752 GCCCTGTGATTACGGTCAATGGG - Intergenic
1119059455 14:71460370-71460392 GCCCTGTGATTAAGATCAATGGG - Intronic
1119527324 14:75333138-75333160 TCCCTGAGAGGACGATCAAGAGG - Intergenic
1124908135 15:33891462-33891484 CACCTGTGAATAAGAACATGTGG + Intronic
1147911486 17:43858635-43858657 ACCCTGTAAACACGATCAGGTGG + Intronic
1167773299 19:51537214-51537236 CCCTTGAGAATACGATCAAGTGG + Intergenic
925460988 2:4062269-4062291 GCCCTGTGATTAAGATCAATGGG + Intergenic
925772496 2:7297195-7297217 GCCCTGTGATTAAGATCAATGGG - Intergenic
935554687 2:104496323-104496345 CCCATGGCAATACCATCAAGTGG + Intergenic
937765877 2:125659815-125659837 ACCCTGTGATTAAGGTCAAGGGG + Intergenic
944905229 2:204255623-204255645 TCCCAGTGAATAAGGTCAAGAGG + Intergenic
946533865 2:220606064-220606086 GCCCTGTGATTAAGATCAATGGG - Intergenic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
1175030742 20:55951262-55951284 CCCTGGTGAATACTTTCAAGAGG - Intergenic
1179414887 21:41190712-41190734 GCCCTGTGATTAAGATCAATGGG - Intronic
1183355707 22:37358171-37358193 GCCATGTGAATAGGATCACGGGG - Intergenic
951397086 3:22181891-22181913 TCCCTGTGAAGAGGATCATGTGG + Intronic
959998121 3:112700114-112700136 GCCCTGTGATTAAGATCAATGGG + Intergenic
960825610 3:121780454-121780476 CCTCTGTGATTACCATAAAGAGG - Intronic
964869404 3:161296831-161296853 GTCCTGTGAAAACTATCAAGTGG - Intergenic
981452654 4:144916402-144916424 GCCCTGTGATTAAGATCAATGGG - Intergenic
986090132 5:4496245-4496267 CCTCTGTGAATGGTATCAAGAGG + Intergenic
988160577 5:27515049-27515071 GCCCTGTGATTAAGATCAATGGG - Intergenic
993321021 5:86467254-86467276 CCCCTGTGATTAAGGTCAATGGG + Intergenic
994291124 5:98030136-98030158 GCCCTGTGATTAAGATCAATGGG - Intergenic
997871827 5:137512814-137512836 CCTCTGTGAATGGTATCAAGAGG - Intronic
1005185415 6:23158882-23158904 CCCCTGTGATTAAGGTCAATGGG + Intergenic
1014414948 6:121172449-121172471 GCCCTGTGATTAAGATCAATGGG + Intronic
1015476008 6:133659313-133659335 ACCCTGTGAATAAGGTCAATGGG + Intergenic
1018854319 6:167664555-167664577 CTCTTGTGAATACAATCATGAGG + Intergenic
1022079141 7:27002157-27002179 GCCCTGTGATTAAGATCAATGGG + Intergenic
1038206284 8:25468983-25469005 ACCCTGTCAAGACGATCAAAAGG + Intronic
1044285722 8:90410630-90410652 GCCCTGTGATTAAGATCAATGGG - Intergenic
1052227829 9:26110200-26110222 GCCCTGTGATTACGGTCAATGGG + Intronic
1055205400 9:73723363-73723385 GCCCTGTGAATAAGATCAGTAGG + Intergenic
1059757474 9:117307097-117307119 CCCCTGTGAAAATGTTCAACCGG + Intronic
1186469505 X:9810316-9810338 GCCCTGTGATTAAGGTCAAGGGG - Intronic
1194240381 X:91437717-91437739 CACCTGTGAATATTATCAAAAGG - Exonic
1194443767 X:93962908-93962930 GCCCTGTGATTAAGATCAATGGG + Intergenic
1199087105 X:143640083-143640105 CCCCTGTGAAAACGAAAATGTGG - Intergenic
1199355026 X:146852475-146852497 CCCCTGTAACTACCATCAAAAGG + Intergenic
1201529425 Y:14976086-14976108 GCCCTGTGAATAAGATCAATGGG - Intergenic