ID: 1064344502 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:14519238-14519260 |
| Sequence | CCCCTGTGAATACGATCAAG TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 56 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 2, 4: 52} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064344497_1064344502 | 0 | Left | 1064344497 | 10:14519215-14519237 | CCTTCTAAAGGAGCCTACCAGGG | 0: 1 1: 0 2: 2 3: 7 4: 56 |
||
| Right | 1064344502 | 10:14519238-14519260 | CCCCTGTGAATACGATCAAGTGG | 0: 1 1: 0 2: 1 3: 2 4: 52 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064344502 | Original CRISPR | CCCCTGTGAATACGATCAAG TGG | Exonic | ||