ID: 1064344502 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:14519238-14519260 |
Sequence | CCCCTGTGAATACGATCAAG TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 56 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 2, 4: 52} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1064344497_1064344502 | 0 | Left | 1064344497 | 10:14519215-14519237 | CCTTCTAAAGGAGCCTACCAGGG | 0: 1 1: 0 2: 2 3: 7 4: 56 |
||
Right | 1064344502 | 10:14519238-14519260 | CCCCTGTGAATACGATCAAGTGG | 0: 1 1: 0 2: 1 3: 2 4: 52 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1064344502 | Original CRISPR | CCCCTGTGAATACGATCAAG TGG | Exonic | ||