ID: 1064345257

View in Genome Browser
Species Human (GRCh38)
Location 10:14526587-14526609
Sequence AGGGGCAGTTCTAGAGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064345257_1064345262 17 Left 1064345257 10:14526587-14526609 CCTTTATCTCTAGAACTGCCCCT No data
Right 1064345262 10:14526627-14526649 ACAGCAGCAAGTATTTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064345257 Original CRISPR AGGGGCAGTTCTAGAGATAA AGG (reversed) Intronic