ID: 1064345262

View in Genome Browser
Species Human (GRCh38)
Location 10:14526627-14526649
Sequence ACAGCAGCAAGTATTTATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064345257_1064345262 17 Left 1064345257 10:14526587-14526609 CCTTTATCTCTAGAACTGCCCCT No data
Right 1064345262 10:14526627-14526649 ACAGCAGCAAGTATTTATTGAGG No data
1064345259_1064345262 -2 Left 1064345259 10:14526606-14526628 CCCTATCTTTTTCCATGTTGTAC No data
Right 1064345262 10:14526627-14526649 ACAGCAGCAAGTATTTATTGAGG No data
1064345260_1064345262 -3 Left 1064345260 10:14526607-14526629 CCTATCTTTTTCCATGTTGTACA No data
Right 1064345262 10:14526627-14526649 ACAGCAGCAAGTATTTATTGAGG No data
1064345258_1064345262 -1 Left 1064345258 10:14526605-14526627 CCCCTATCTTTTTCCATGTTGTA No data
Right 1064345262 10:14526627-14526649 ACAGCAGCAAGTATTTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064345262 Original CRISPR ACAGCAGCAAGTATTTATTG AGG Intronic