ID: 1064346062

View in Genome Browser
Species Human (GRCh38)
Location 10:14533878-14533900
Sequence CTCTAATAGGAGACAGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064346062_1064346071 9 Left 1064346062 10:14533878-14533900 CCCAAGCCTGTCTCCTATTAGAG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1064346071 10:14533910-14533932 CACTGCGAGCCGGTGCAGGAGGG No data
1064346062_1064346076 14 Left 1064346062 10:14533878-14533900 CCCAAGCCTGTCTCCTATTAGAG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1064346076 10:14533915-14533937 CGAGCCGGTGCAGGAGGGGGGGG No data
1064346062_1064346069 5 Left 1064346062 10:14533878-14533900 CCCAAGCCTGTCTCCTATTAGAG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1064346069 10:14533906-14533928 CGGGCACTGCGAGCCGGTGCAGG No data
1064346062_1064346072 10 Left 1064346062 10:14533878-14533900 CCCAAGCCTGTCTCCTATTAGAG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1064346072 10:14533911-14533933 ACTGCGAGCCGGTGCAGGAGGGG No data
1064346062_1064346074 12 Left 1064346062 10:14533878-14533900 CCCAAGCCTGTCTCCTATTAGAG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1064346074 10:14533913-14533935 TGCGAGCCGGTGCAGGAGGGGGG No data
1064346062_1064346068 -1 Left 1064346062 10:14533878-14533900 CCCAAGCCTGTCTCCTATTAGAG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1064346068 10:14533900-14533922 GAGACACGGGCACTGCGAGCCGG No data
1064346062_1064346073 11 Left 1064346062 10:14533878-14533900 CCCAAGCCTGTCTCCTATTAGAG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1064346073 10:14533912-14533934 CTGCGAGCCGGTGCAGGAGGGGG No data
1064346062_1064346070 8 Left 1064346062 10:14533878-14533900 CCCAAGCCTGTCTCCTATTAGAG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1064346070 10:14533909-14533931 GCACTGCGAGCCGGTGCAGGAGG No data
1064346062_1064346078 20 Left 1064346062 10:14533878-14533900 CCCAAGCCTGTCTCCTATTAGAG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1064346078 10:14533921-14533943 GGTGCAGGAGGGGGGGGCTGCGG No data
1064346062_1064346075 13 Left 1064346062 10:14533878-14533900 CCCAAGCCTGTCTCCTATTAGAG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1064346075 10:14533914-14533936 GCGAGCCGGTGCAGGAGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064346062 Original CRISPR CTCTAATAGGAGACAGGCTT GGG (reversed) Intronic
902969285 1:20034926-20034948 CACTAATTGGAGACAGGTGTTGG + Intronic
905703717 1:40039207-40039229 CTCTACTAGGGGTCAGACTTTGG - Intergenic
906716766 1:47975860-47975882 CTGAAATAGGAAACAGGATTTGG + Intronic
913590708 1:120322021-120322043 TTCAAATATGAGACAGTCTTGGG - Intergenic
914600103 1:149195922-149195944 TTCAAATATGAGACAGTCTTGGG + Intergenic
915846914 1:159276425-159276447 CTCTGTTAGGAGACAGCCTAGGG + Intergenic
915873322 1:159585372-159585394 CTCTAATGGGAGATAAGCCTAGG - Intergenic
916197494 1:162238179-162238201 CTTGAATAGGAGGCAGGGTTGGG + Intronic
917151954 1:171955645-171955667 CCCTAATAGGTGAGAGGCATAGG + Intronic
917179698 1:172282743-172282765 CTCTACTTGGAGAGAGTCTTAGG + Intronic
917680579 1:177362155-177362177 CCCAGAAAGGAGACAGGCTTGGG + Intergenic
917996618 1:180445894-180445916 ATTTAATAGAACACAGGCTTTGG - Intronic
921787149 1:219244473-219244495 CCCTAATAGGAGACAGGTGTCGG + Intergenic
1063814770 10:9759278-9759300 CTGTAATAGGAGATAGGATGGGG - Intergenic
1064346062 10:14533878-14533900 CTCTAATAGGAGACAGGCTTGGG - Intronic
1064711888 10:18136540-18136562 TTCTCATGGGAGTCAGGCTTAGG + Intergenic
1065902029 10:30216823-30216845 CTGTAATGGGATACAGGCTAAGG + Intergenic
1067248410 10:44565957-44565979 CTCTAAGAGGAGACAGGCCTGGG + Intergenic
1067477667 10:46577622-46577644 CTCTACTTGGAGACAGTCTGGGG - Intergenic
1067617073 10:47764162-47764184 CTCTACTTGGAGACAGTCTGGGG + Intergenic
1068478046 10:57552579-57552601 TTCTAAGAGGAAACTGGCTTGGG + Intergenic
1068620030 10:59172327-59172349 CTCTTATAGGAGATATGTTTGGG + Intergenic
1070169267 10:73920449-73920471 CACTAATAGGAGGCAGTCTCTGG - Intronic
1070305758 10:75238253-75238275 CTCTAATCAGAGACAGGGTGGGG + Intergenic
1070839191 10:79471440-79471462 CTGTAATAGGAGCGAGCCTTAGG + Intergenic
1071038002 10:81270473-81270495 CTCTATTAGGAGACAGCACTGGG - Intergenic
1076915404 10:133420967-133420989 CTCTTCTAGGACACAGGCTGTGG - Exonic
1077721688 11:4636811-4636833 CTCTAGAAGGAAACAGACTTGGG - Intergenic
1080816404 11:35761785-35761807 CTTTAAGAGGAGACATGCATAGG - Intronic
1083617751 11:64035023-64035045 CTCTAATAGGTGCCAGGCACTGG + Intronic
1084595595 11:70115074-70115096 CACTAAAAGGAGTCAGGCTTGGG + Intronic
1091481280 12:834274-834296 CTCTGAGATGAGACAGGATTTGG - Intronic
1098338702 12:69429751-69429773 CACTAAGAGGTGACAGGATTGGG + Intergenic
1102090679 12:110184751-110184773 CTCTAATAGGTGACTGGCTCAGG - Intronic
1108520000 13:51238039-51238061 CACTAATAGGCCACAGGCCTGGG + Intronic
1109015216 13:57001250-57001272 ATCTAATGGGAGACAGGATAAGG + Intergenic
1111716931 13:91889952-91889974 CTCTAATAGAACACTGGATTGGG + Intronic
1114449317 14:22814540-22814562 CTATAATACAAGACAGGCATGGG + Intronic
1115896156 14:38089982-38090004 CCCTAATAAGTGCCAGGCTTTGG + Intergenic
1117778107 14:59202909-59202931 CCCTAGTAGTAGAAAGGCTTGGG - Intronic
1121401383 14:93680860-93680882 CTCTACCAGGAGACTGGGTTGGG + Intronic
1127899617 15:63331278-63331300 CTCTGCTGGGAAACAGGCTTTGG - Intronic
1136687052 16:32001829-32001851 CTCAGACAGGAGATAGGCTTAGG - Intergenic
1136994473 16:35180070-35180092 CCCTATTAGCAGACAGGGTTTGG + Intergenic
1142424107 16:89991741-89991763 CTCTGAGAGGAGGCAGGCCTGGG - Intergenic
1144064116 17:11608894-11608916 TTCTAAAAGGAGACAAGCCTGGG - Intronic
1146300549 17:31685861-31685883 CTTTAATAGGAGGCAGCCTGAGG - Intergenic
1147148017 17:38497500-38497522 CTCAGACAGGAGATAGGCTTAGG - Intronic
1148129853 17:45256200-45256222 CTCTGAGAGGAGGCAGGCATGGG - Intronic
1154183461 18:12158130-12158152 CTCTATTCAGAGACAGGCCTAGG + Intergenic
1155779996 18:29819452-29819474 CTCTAATAGGAGAAAAGCAATGG - Intergenic
1156838574 18:41584779-41584801 CTCCATTAGGAGACTGGGTTTGG + Intergenic
1157380843 18:47215177-47215199 CTCTAGCAGTAGACAGACTTTGG - Intronic
1157460135 18:47884060-47884082 CAGTGATAGGAGACTGGCTTGGG - Intronic
1159026333 18:63185105-63185127 CTCTCACAGAACACAGGCTTTGG + Intronic
1159083004 18:63756505-63756527 CTTTAATAAGAGACTGGTTTGGG - Intronic
1160248580 18:77181191-77181213 ATCTAAGAGCAGACAGGCATTGG - Intergenic
1163057768 19:14734145-14734167 CACTAACAGGAGCCAGGGTTAGG - Exonic
1164396205 19:27866034-27866056 CTCTAATAGGAGAGACACATGGG + Intergenic
1164526749 19:29018665-29018687 CTTTACAAGGAGACAGCCTTGGG + Intergenic
925625565 2:5839469-5839491 CTCTGATAGGAGAAATGCTTAGG - Intergenic
926613386 2:14970544-14970566 CTCTAATAGAACACAGGAGTAGG + Intergenic
929134038 2:38605775-38605797 CTGGAGTAGGAGACAGGCTTAGG + Intergenic
931715270 2:65023929-65023951 CTCTTCTAGGAGATGGGCTTTGG + Intergenic
932248483 2:70218749-70218771 CGCTAAGAGGAGAATGGCTTAGG + Intronic
936099481 2:109562629-109562651 CTCTCTGAGGAGACAGGCCTAGG - Intronic
940963144 2:159808106-159808128 CTCTAAGAGAAGGCAGGCATGGG + Intronic
941050677 2:160729985-160730007 CTCAGATGTGAGACAGGCTTGGG - Intergenic
942936141 2:181558596-181558618 CTCTGACAGGAGTCAGGATTCGG + Exonic
943432010 2:187815602-187815624 GTAGGATAGGAGACAGGCTTAGG - Intergenic
945030094 2:205655280-205655302 CACTAATTGGAGGCAGGATTTGG - Intergenic
1170395517 20:15921434-15921456 CTCTTATGTGAGAAAGGCTTTGG - Intronic
1171445324 20:25198787-25198809 CTATGAGAGGTGACAGGCTTGGG - Intronic
1173311368 20:41899013-41899035 CTTTCAGAGGAGGCAGGCTTTGG + Intergenic
1175727928 20:61332178-61332200 CTCCTCCAGGAGACAGGCTTTGG + Intronic
1176249288 20:64112593-64112615 CCCCAAGAGGAGACAGGCCTGGG - Intergenic
1182911721 22:33990031-33990053 CTCTAAAATGAGAAAGCCTTGGG - Intergenic
1185146809 22:49141617-49141639 CACTACAAGGGGACAGGCTTAGG - Intergenic
950614838 3:14150218-14150240 CTCTTAGAGGAGTCAGGCATGGG + Intronic
953521756 3:43649688-43649710 AGCTAATAGGAGACAGAGTTGGG + Intronic
954865047 3:53721521-53721543 TTCTAGAAGGAGACAGGCTAAGG + Intronic
956027500 3:64999062-64999084 CTTTAGGAGGAGGCAGGCTTGGG + Intergenic
959571669 3:107891129-107891151 CTTTAATAGGAGTCAGGGTCAGG - Intergenic
963717465 3:148820451-148820473 CTCTACTGTGAGACATGCTTGGG + Intronic
963787971 3:149554340-149554362 GTCTAAAACTAGACAGGCTTGGG - Intronic
965397893 3:168182604-168182626 TTCTAATAAGAGATGGGCTTTGG + Intergenic
967092736 3:186149187-186149209 CTCAAACAGGAAACACGCTTTGG + Exonic
969074064 4:4563474-4563496 CTCTGATAGGGGAGAGGGTTGGG - Intergenic
971153810 4:24061557-24061579 CTCAAAGAGGAGTCAGGATTAGG + Intergenic
971209552 4:24602607-24602629 CTTGAACAGGAGACAGCCTTTGG - Intergenic
972902201 4:43699303-43699325 CTTTAATAGAAGACTGGATTAGG - Intergenic
973716450 4:53681835-53681857 CACCAATAGGAGACAGAGTTTGG - Intronic
974828507 4:67160250-67160272 CTCAGAGAGGAGAGAGGCTTGGG - Intergenic
975462279 4:74668315-74668337 ATTTAACAGGGGACAGGCTTTGG + Intergenic
977531803 4:98209156-98209178 CAGGAATAGGAGACAGGCCTGGG - Intergenic
978994308 4:115131112-115131134 ATCCAATAGGAGACTGGCATAGG + Intergenic
979199198 4:117956664-117956686 CTCTAACAGAAGACATGCTAAGG + Intergenic
985705536 5:1399589-1399611 CTCTCAGAGGAGAGAGGCTCTGG + Intronic
986784482 5:11100590-11100612 CTCTCAAAGGAGACCAGCTTGGG + Intronic
988905934 5:35788937-35788959 CTCAAATAGGAGACAGGAAGTGG + Intronic
989340526 5:40369082-40369104 CTCTAAGAAGATACAGGTTTTGG + Intergenic
990402383 5:55451894-55451916 CTCTAACAGCAGAAGGGCTTGGG - Intronic
990924846 5:61008946-61008968 CTCAAATAGAAGACACACTTGGG - Intronic
993575774 5:89598509-89598531 GTCTGATAGGGTACAGGCTTTGG - Intergenic
994174812 5:96700078-96700100 CTGTAATAGGAGTGAGGGTTTGG + Intronic
994933780 5:106224077-106224099 CACTATTAGGAGACAGATTTTGG - Intergenic
997357670 5:133274231-133274253 CCCAAATAGGACACAGGCTGAGG - Intronic
999480185 5:151940986-151941008 CTCCCTTAGGAGACAGCCTTTGG + Intergenic
999658554 5:153834556-153834578 CTCTAATACAAGAAACGCTTTGG - Intergenic
999844057 5:155459160-155459182 CTCTAGAAGGAGACAGACCTGGG - Intergenic
1004103940 6:12645714-12645736 CTCTATTAGGAGACAGCACTTGG - Intergenic
1005855706 6:29861487-29861509 TTCTAATGGGAGAGAGCCTTGGG + Intergenic
1006591511 6:35161308-35161330 CTCTAAGAAGAAACAGGATTAGG + Intergenic
1008105729 6:47439263-47439285 GTCTATTAGGAGACAGGCATGGG + Intergenic
1011960299 6:93080453-93080475 CTCCAAGAGGAAACATGCTTAGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1014875674 6:126655609-126655631 CTCAAATGGGATACAGGCATTGG - Intergenic
1020439087 7:8198286-8198308 CTCTGCTAGGAGACAGGTTGAGG - Intronic
1021132016 7:16922790-16922812 CTCTAATAGGAGAAGTGGTTGGG + Intergenic
1028511492 7:91629857-91629879 GTTTTATAGGAGACTGGCTTAGG - Intergenic
1032990782 7:137392812-137392834 CTCTAATAGGAGAAATTCTCAGG + Intronic
1033506275 7:142004529-142004551 CTCCAAAAGGAGAAAGGGTTAGG + Intronic
1033910239 7:146254526-146254548 TTCTAATAGGACACTGCCTTTGG - Intronic
1033975936 7:147100834-147100856 CTCTTCTAGGATACAGGCTTTGG - Intronic
1034859408 7:154582935-154582957 ATCCATTAGGAGACGGGCTTTGG + Intronic
1038989056 8:32845823-32845845 TTCTAGTAGGAGACAGGGATAGG + Intergenic
1039885645 8:41652719-41652741 CTCTAATGGGAGAATGGATTAGG - Intergenic
1041108683 8:54466346-54466368 CTATAAAAGGGGAAAGGCTTAGG + Intergenic
1041349364 8:56933350-56933372 CAGAAATAGGAGGCAGGCTTTGG - Intergenic
1045022330 8:98054521-98054543 CTCTCTTTGGAGACAGACTTGGG + Intergenic
1045221199 8:100202032-100202054 CTGGAGTAGGAGACAGCCTTGGG + Intronic
1049374795 8:142284293-142284315 CTCTAAGAGGAGCCAGGCCCAGG - Intronic
1049560676 8:143308465-143308487 CTCTGAGAGGATACAGGGTTGGG + Intronic
1050491256 9:6190321-6190343 CTCTTAGAGGAGAAAGGCTCTGG - Intergenic
1058753260 9:108060219-108060241 ATCCAGTAGGAGAGAGGCTTTGG + Intergenic
1059649916 9:116306535-116306557 CTATAATAAGAGACATTCTTTGG + Intronic
1061661626 9:132134004-132134026 CTCTAATTGGAGATGGGATTGGG + Intergenic
1061819809 9:133220816-133220838 CCCTTATAGGAGAGAGGCTGGGG + Intergenic
1061850888 9:133414594-133414616 CTCCATAAGGAGACAGGCCTTGG + Intronic
1062240847 9:135537132-135537154 CCCTTATAGGAGAGAGGCTGGGG - Intergenic
1190980386 X:55452361-55452383 CTCTAGCAGGAGACATGCCTCGG + Exonic
1191721320 X:64230846-64230868 CTCAAATGGGAGACAGGGTGAGG + Intergenic
1195604126 X:106783232-106783254 CTTATATAGGAGACAGGTTTGGG + Intronic
1196418053 X:115494316-115494338 TTATAGTAGGAGACAGGCCTTGG - Intergenic
1197902560 X:131389844-131389866 CACTAACAGGAGACAGCTTTGGG - Intronic
1197944268 X:131821751-131821773 CTCTATTAGGGGACAGGCCTTGG + Intergenic
1199247519 X:145624461-145624483 TTGTTATAGGAGACATGCTTAGG + Intergenic
1199581569 X:149365780-149365802 ATGTAAAAGGAGAGAGGCTTAGG + Intergenic