ID: 1064346515

View in Genome Browser
Species Human (GRCh38)
Location 10:14537432-14537454
Sequence CTTAGAGCAAGTGAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064346515_1064346521 15 Left 1064346515 10:14537432-14537454 CCAGCTTCCTCACTTGCTCTAAG 0: 1
1: 0
2: 0
3: 26
4: 267
Right 1064346521 10:14537470-14537492 GGGCCTTCGCCAGTTTAACAAGG No data
1064346515_1064346519 -6 Left 1064346515 10:14537432-14537454 CCAGCTTCCTCACTTGCTCTAAG 0: 1
1: 0
2: 0
3: 26
4: 267
Right 1064346519 10:14537449-14537471 TCTAAGTGTGATCTTGGGTAAGG No data
1064346515_1064346520 -5 Left 1064346515 10:14537432-14537454 CCAGCTTCCTCACTTGCTCTAAG 0: 1
1: 0
2: 0
3: 26
4: 267
Right 1064346520 10:14537450-14537472 CTAAGTGTGATCTTGGGTAAGGG No data
1064346515_1064346524 30 Left 1064346515 10:14537432-14537454 CCAGCTTCCTCACTTGCTCTAAG 0: 1
1: 0
2: 0
3: 26
4: 267
Right 1064346524 10:14537485-14537507 TAACAAGGCAACAATGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064346515 Original CRISPR CTTAGAGCAAGTGAGGAAGC TGG (reversed) Intronic
900691337 1:3982314-3982336 CTTTCAGGAAGTGAGGGAGCTGG + Intergenic
902771485 1:18647721-18647743 CTTGGAGGAAATGAGGAGGCAGG - Intronic
903579028 1:24357366-24357388 CCCAGAGCCAGTTAGGAAGCTGG + Exonic
903673693 1:25051488-25051510 CTGAGACCCAGTGAGGAAGCTGG - Intergenic
903952422 1:27004141-27004163 CTCAGAGCAGGTGAGGTGGCTGG + Intergenic
906687742 1:47773215-47773237 CTTGAAGCAAGTGAAGGAGCTGG - Intronic
907861687 1:58359883-58359905 CAAAGAGTAAGTGATGAAGCAGG - Intronic
908354861 1:63319273-63319295 ATTTGAGCAGGTGAGGCAGCTGG + Intergenic
908661551 1:66442168-66442190 TTTAGAGCAATTGAAGGAGCAGG - Intergenic
909618748 1:77643925-77643947 CTTACAACAAGTGAAGAATCAGG - Intronic
911293231 1:96082767-96082789 CATAGAGCAAATGATGGAGCTGG + Intergenic
911819863 1:102404313-102404335 CACATAGCAAGTGAGGAAGCAGG - Intergenic
915555294 1:156657782-156657804 CTTAGAGGAAGTGAGCTAGACGG - Intronic
916060670 1:161096587-161096609 CTCAGAGTCAGAGAGGAAGCTGG + Intergenic
917002643 1:170376198-170376220 ATGAGAACAAGTTAGGAAGCAGG + Intergenic
919609271 1:199725210-199725232 CTTAGAGTCTGAGAGGAAGCCGG + Intergenic
919618374 1:199835413-199835435 CAGAGACCAAGTGGGGAAGCTGG + Intergenic
920713214 1:208315375-208315397 GTTACAGGGAGTGAGGAAGCCGG - Intergenic
921628209 1:217402091-217402113 CCTAGAACAAGTGAGGCATCAGG - Intergenic
923612572 1:235507853-235507875 CTTAGTGCAAGTTAGGAACACGG + Intergenic
1063309416 10:4938355-4938377 ATCAGAGCAAGTGAGGTAGAAGG + Intronic
1064346515 10:14537432-14537454 CTTAGAGCAAGTGAGGAAGCTGG - Intronic
1065251816 10:23823265-23823287 CTGAGAGCAGGCAAGGAAGCAGG - Intronic
1065774560 10:29107397-29107419 CTCAGTGCCAGAGAGGAAGCTGG + Intergenic
1066304573 10:34128152-34128174 CTTAGTTCAGGTGAGGAAGATGG - Intronic
1066565006 10:36712516-36712538 CTGAGAGCTACTGAGGCAGCCGG + Intergenic
1068472120 10:57478673-57478695 CTTAGCTCAAGGGAGGAAGTGGG + Intergenic
1071629653 10:87208049-87208071 CTTAGAAGAAGGGAGGAAGATGG + Intergenic
1072518314 10:96208380-96208402 CCTAGAGACAGGGAGGAAGCTGG - Intronic
1073187130 10:101622222-101622244 GCTACAGCAACTGAGGAAGCAGG + Intronic
1074161987 10:110843095-110843117 CTGAGGGCAAGAGAGGAAGGAGG + Intergenic
1075090387 10:119441154-119441176 CTTAGACCAAGGGAGGCACCGGG - Intronic
1075289802 10:121219222-121219244 CTTAGAGCAAGTTAGAATTCTGG + Intergenic
1075857773 10:125644976-125644998 CTAACAGCAAATGAGGAAGCAGG + Intronic
1075936853 10:126350426-126350448 CTTTGAGAAAGGGAGGAAGAGGG + Intronic
1076436870 10:130452566-130452588 CTCAGAGTGAGTGTGGAAGCTGG - Intergenic
1078106098 11:8358903-8358925 CTTTGATCACGTGAGGAAGGTGG - Intergenic
1078597260 11:12698192-12698214 GTTTGTGCAAGTGAGGAAGCGGG + Intronic
1078619572 11:12894556-12894578 CTTAGAGGAAGGTAGGAAGCAGG + Intronic
1078885835 11:15499057-15499079 CTTGGGGGAACTGAGGAAGCCGG - Intergenic
1081955428 11:47088038-47088060 CTTAGAAGAAGAGAGCAAGCAGG + Intronic
1082222624 11:49658609-49658631 AGTAGGGCAAGTGTGGAAGCAGG - Intergenic
1084387769 11:68854869-68854891 CTTAGAGGAGCTGAGGAAGGCGG - Intergenic
1085039092 11:73316544-73316566 CCTGGAGGAAGTGAGGGAGCAGG + Intronic
1086073622 11:82826121-82826143 CTGAGAGCAAGGCAGGAAGATGG - Intronic
1086115208 11:83242322-83242344 CATAGGGCAAGAGTGGAAGCAGG + Intronic
1086626423 11:88960593-88960615 AGTAGGGCAAGTGTGGAAGCAGG + Intronic
1088054371 11:105557291-105557313 CATAGAGCAATTGAGGAGGTTGG + Intergenic
1088959737 11:114650938-114650960 CTGAGAGCACATCAGGAAGCAGG + Intergenic
1089162255 11:116447598-116447620 TTTATAGCCAGTGAGGAAGGGGG + Intergenic
1089894958 11:121920926-121920948 TTTAGAGCAAGTGAGCCATCTGG + Intergenic
1090031892 11:123213512-123213534 CCAAGAGCAATTGAGGAAGCAGG - Intergenic
1090853751 11:130593752-130593774 GTTAGAGAAAATGAGGAAGGAGG + Intergenic
1091469524 12:714781-714803 GTGAGAGCAAGAGAGAAAGCAGG + Intergenic
1092286548 12:7132012-7132034 ATTAGAGCAAGCGTGGAGGCTGG + Intronic
1093205667 12:16245987-16246009 CTTTGATTAATTGAGGAAGCTGG + Intronic
1095393836 12:41740922-41740944 TTTGGAGCAAGAGAGGAAGAAGG + Intergenic
1097008612 12:55936649-55936671 CTCAAAGCCACTGAGGAAGCTGG - Intronic
1097022725 12:56032260-56032282 CTTAAAGGAAGTGAGGACCCAGG - Intronic
1098217421 12:68235054-68235076 CCTAGAGCAGGCGAGGAAGCTGG - Intergenic
1098610299 12:72449075-72449097 CTTAGAGGAAAAGAGGAAGCTGG - Intronic
1099434537 12:82627798-82627820 CTGAGAGCAAGAGACAAAGCGGG + Intergenic
1100246145 12:92758889-92758911 CTAAGATCAAGTGAGGAAACAGG + Intronic
1100657452 12:96661973-96661995 GTGAGAGCAAGAGAGGAGGCAGG - Intronic
1101302085 12:103493517-103493539 CCTAAAGCAAGTGAGAATGCAGG - Intronic
1101445694 12:104735536-104735558 CTTAGAGGAAGTGAGGAATATGG + Intronic
1102783931 12:115588573-115588595 CTTAGATCAAATGCAGAAGCAGG + Intergenic
1103612036 12:122129821-122129843 CTCAGTGGAAGTGAGGCAGCAGG - Intronic
1104726224 12:131077222-131077244 CTTGGAGCAGCTGAGGAAGGGGG + Intronic
1109538073 13:63741420-63741442 CTAAGAGCCAGTGGGGAAGAGGG + Intergenic
1112146435 13:96705546-96705568 CTGAGTGCAAGGGAGGAAGAGGG - Intronic
1113146909 13:107217721-107217743 CATAGAGCTATTGAGGAAGCAGG - Intronic
1113443842 13:110350624-110350646 TTTAGAGATAGTGAGAAAGCTGG - Intronic
1117491345 14:56250932-56250954 GTGAGAGCAAGGGAAGAAGCTGG + Intronic
1119348403 14:73944656-73944678 CTTTGAGCAGGAGAGGCAGCGGG - Exonic
1119449849 14:74700019-74700041 CCCACAGCAAGTGAGGAAGATGG + Intronic
1120857010 14:89221606-89221628 CTTTGATCCAGTGAGGAAGTTGG - Intronic
1120957227 14:90093503-90093525 TCTAGGGCAAGTCAGGAAGCAGG + Intronic
1122186076 14:99997267-99997289 CTTTGAGGAAGTTAAGAAGCTGG + Intronic
1122797511 14:104213383-104213405 CTAATAGCCAGTGAGAAAGCAGG + Intergenic
1123670749 15:22654411-22654433 CTTTCACCAAGTGAGGATGCAGG + Intergenic
1124526723 15:30460838-30460860 CTTTCACCAAGTGAGGATGCAGG + Intergenic
1124627028 15:31313836-31313858 CCTAGAGCAAGTGATCAAGAGGG - Intergenic
1124771930 15:32546845-32546867 CTTTCACCAAGTGAGGATGCAGG - Intergenic
1125284818 15:38081081-38081103 CTTAGAGGAAGTAAAGAAGCTGG - Intergenic
1125628667 15:41130007-41130029 TGTAGAGCAAGTGAGGGATCTGG + Intergenic
1129173085 15:73819857-73819879 CTTAGAGCATGTTCTGAAGCTGG - Intergenic
1129708207 15:77806675-77806697 CCTAGAGTATCTGAGGAAGCAGG - Intronic
1133901268 16:9977285-9977307 CTTGGAGCAAGGGAGGAAGGGGG + Intronic
1139730854 16:68943919-68943941 CTTAGAGCAAGAGAGTAAGAAGG + Intronic
1140887952 16:79261089-79261111 CCGGGAGCAGGTGAGGAAGCTGG + Intergenic
1142767808 17:2075514-2075536 CAGAGAGGCAGTGAGGAAGCGGG + Intronic
1142889150 17:2931788-2931810 CTCCCAGCAAGTGAGGAGGCTGG + Intronic
1143729565 17:8873303-8873325 CATAGAGGAGGAGAGGAAGCTGG - Intergenic
1144133543 17:12270837-12270859 CTTAGAGCAAGAGAGTAACTGGG - Intergenic
1145013581 17:19383108-19383130 CTTCGAGCCAGTCAGCAAGCAGG - Exonic
1145890161 17:28408452-28408474 CTTGAAGGAAGTGAGGGAGCCGG - Intergenic
1145912436 17:28550431-28550453 CTTAGAAGAAGTGAGGAACACGG + Intronic
1147008004 17:37420098-37420120 CTAACAGGAAGTGAGGAAGAGGG + Intronic
1147892743 17:43728902-43728924 CTGAGAGGAAAAGAGGAAGCTGG - Intergenic
1147961546 17:44170711-44170733 CTCAGAGCAAGGGAGGTAGTCGG + Exonic
1148608920 17:48950907-48950929 CAAAGAGTAAGGGAGGAAGCAGG - Intergenic
1148898488 17:50855609-50855631 CTTAGTGCTAGTGAGAAAGCTGG - Intergenic
1148992241 17:51676360-51676382 GTAAGAGCAAGTGAGCAAGAGGG - Intronic
1150121573 17:62607708-62607730 CTCAGAGCAGGTGAGGTTGCTGG + Intronic
1151050242 17:70970090-70970112 CTTAGAGGAAGTGAGGCAATGGG + Intergenic
1151980071 17:77503372-77503394 CCTGGAGCAGGAGAGGAAGCAGG - Intergenic
1153350646 18:4077588-4077610 CACACAGCAAGAGAGGAAGCAGG - Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153691674 18:7600684-7600706 CCTGCAGCTAGTGAGGAAGCAGG - Intronic
1156048976 18:32908826-32908848 CATACAGCAAGTGTGGAAGGTGG + Intergenic
1156631590 18:38975773-38975795 CTTAGAGCAAGCGAAGGAGAGGG + Intergenic
1158695330 18:59697942-59697964 CTTAGATTATGTGAGGAAGGAGG + Intergenic
1159311203 18:66712235-66712257 CTGAGAGCAAGTCAGCAAGGTGG + Intergenic
1159894522 18:73983637-73983659 TTGAGAACAAGTGAGAAAGCAGG + Intergenic
1160709688 19:545274-545296 CATAAACCAAGGGAGGAAGCCGG + Intronic
1161250743 19:3279001-3279023 TTTAGAGCAAGGGAGGAGACAGG + Intronic
1163530324 19:17844904-17844926 CTCAGGGCAAGTGAGCGAGCGGG - Intronic
1165296448 19:34930148-34930170 CATTGAGCAAGTTACGAAGCAGG + Intronic
1165688749 19:37845733-37845755 CTGAGAGCTAGAGATGAAGCAGG + Intergenic
1166867773 19:45851169-45851191 CTGAGTGCAAGAGTGGAAGCGGG + Intronic
927467413 2:23347810-23347832 CAGAGGGCCAGTGAGGAAGCAGG + Intergenic
929384825 2:41394174-41394196 CTTAGATAAAGTGAGGTAGAGGG - Intergenic
929875919 2:45796281-45796303 CTTACAGCTAGTGAGAGAGCTGG - Intronic
931008113 2:57876047-57876069 CTTGGAGCTAATGAGGAAGGGGG + Intergenic
931836345 2:66102351-66102373 ATTAGAGACAGTGAGGAAGTTGG + Intergenic
933449204 2:82424820-82424842 CTTACAGCAAGCAAGGAAGTGGG + Intergenic
933665002 2:84957763-84957785 CTTAGAGGAAGGAAGGAAGCAGG - Intergenic
933939533 2:87233896-87233918 GTTAGGGCAAGTGAGCAGGCAGG + Intergenic
935699832 2:105801868-105801890 CTGAGAGAAAGTGATGGAGCTGG + Intronic
936353602 2:111731877-111731899 GTTAGGGCAAGTGAGCAGGCAGG - Intergenic
936921003 2:117688037-117688059 CAGAGAGCAAGTGAGGAACCAGG + Intergenic
937538139 2:122916294-122916316 CATAGAGCAAGCAAGGGAGCTGG + Intergenic
938168860 2:129057325-129057347 CTTAGAGCAAGAAAGCAGGCAGG - Intergenic
940007052 2:149017361-149017383 CTGAGAGAGAGGGAGGAAGCAGG + Intronic
940349461 2:152665607-152665629 CAGGGAGCAAGTGAGGAAGCTGG - Intronic
942132499 2:172894169-172894191 CTTAGAGCAAAAGAAGAAGGTGG - Intronic
943446154 2:187990399-187990421 CTCAGAGCTAGTGAGTAAGAGGG - Intergenic
943573273 2:189600021-189600043 TTTAGACCAAGTGAAGATGCTGG + Intergenic
946291974 2:218752416-218752438 CTCAGAGCAGATAAGGAAGCTGG + Intronic
946349471 2:219140042-219140064 CTTTAAGGAAGTGAGGAAGTTGG + Intronic
947707556 2:232288675-232288697 CTCAGAGCCAGTGATCAAGCTGG - Intronic
948082890 2:235220857-235220879 ATTAAAGCAAATGAGGAATCTGG - Intergenic
948876988 2:240834757-240834779 CTTAGAGGATGGGAGGAAGCAGG + Intergenic
1169066312 20:2696004-2696026 CTTCAAGCCAGGGAGGAAGCGGG - Intronic
1169113751 20:3049350-3049372 CTTATTGCAGGTGAGAAAGCAGG + Intergenic
1172525191 20:35596592-35596614 TTTAGAGGCAGGGAGGAAGCAGG - Intergenic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1172903151 20:38349488-38349510 TTTAGAGCAGGGGAGGAGGCAGG + Intronic
1172972578 20:38884139-38884161 CCTGGAGCAATGGAGGAAGCTGG - Intronic
1173072037 20:39777452-39777474 CTGAAAGCAAGAGAGGAAGAGGG + Intergenic
1173074807 20:39807518-39807540 CTGACAGCCAGTGAGGAAACAGG + Intergenic
1173085344 20:39910754-39910776 CTGACAGCCAGTGAGGAAACAGG + Intergenic
1173241072 20:41297668-41297690 CCCAGAGCAAGTGAGGAAATGGG + Intronic
1173653847 20:44685311-44685333 CTTAGACCAGGAGAGGAGGCAGG - Intergenic
1174332852 20:49833672-49833694 CTTAGGGCCAGTAAGGATGCTGG - Intronic
1174609067 20:51784288-51784310 CTTCCAGGAAGTGAGGAAACTGG + Exonic
1175048682 20:56132414-56132436 CTGAGATTAATTGAGGAAGCGGG - Intergenic
1175248179 20:57593695-57593717 CTTGGAGCAAACGAGGAAGAAGG + Intergenic
1175625193 20:60483892-60483914 CTGGGAGCAGGAGAGGAAGCAGG + Intergenic
1175761262 20:61563414-61563436 CCTGGAGCAAGTGAGGGAGAAGG - Intronic
1175951807 20:62587658-62587680 CAGAGAGCAAGTTAGGGAGCCGG + Intergenic
1177721391 21:24911065-24911087 CTTAGAACAAGGGAGAAATCTGG - Intergenic
1178472224 21:32903919-32903941 CATAGAGCAGGGGTGGAAGCAGG + Intergenic
1178483997 21:33005544-33005566 CTTCCATCAAGTGAGGATGCAGG + Intergenic
1179101556 21:38359272-38359294 CATGGAGGAAATGAGGAAGCAGG + Intergenic
1179265375 21:39798201-39798223 CTTATAGCAAGAGGGGAATCAGG + Intronic
1181566442 22:23741727-23741749 CTCAGAGCTAGTGGGGAAGGAGG - Exonic
1182756304 22:32682422-32682444 ATAAGGGCAAGGGAGGAAGCAGG + Intronic
1183479765 22:38057132-38057154 CTGAGTGCAGCTGAGGAAGCTGG + Intronic
1203292713 22_KI270736v1_random:10777-10799 CTTAGAGCTACTGGGAAAGCTGG + Intergenic
949808342 3:7978907-7978929 AATAGAGAAAGTGAGGAAGTGGG - Intergenic
950099259 3:10347083-10347105 CTGAGACCAAGGGGGGAAGCAGG - Intronic
950377541 3:12584160-12584182 TTTAGAGGAAGTAAGGTAGCAGG - Exonic
950939201 3:16876428-16876450 CTTGGAGGAAGTGATGGAGCTGG - Intronic
953287359 3:41625036-41625058 GTTAAAGCAAGTAAGGAAGAAGG + Intronic
953738060 3:45513291-45513313 CTGAGAGCTACTGAGCAAGCAGG + Intronic
954638921 3:52086540-52086562 CTTACACCAAGTGACAAAGCTGG - Intronic
955643377 3:61110387-61110409 CTTAGATCAAGTGATCTAGCAGG - Intronic
955706905 3:61737182-61737204 CTTAGAGAGAGAGAGGAGGCAGG - Intronic
957077634 3:75614264-75614286 CTTAGAGCCAGTGGGGGAGAGGG + Intergenic
957725435 3:84059323-84059345 CTTAGAGCATGTGATGTGGCAGG + Intergenic
958870245 3:99550167-99550189 TTTAGAGCAAGCCAGGAAGCTGG - Intergenic
959933230 3:112004424-112004446 ATTAGAGCAAGTGAGTGTGCTGG + Intronic
960160049 3:114340424-114340446 CTGAGAGCAAAGGAGGACGCAGG - Intronic
960939956 3:122927115-122927137 CTAATAGTTAGTGAGGAAGCAGG + Intronic
962741364 3:138364685-138364707 CTGAGGACCAGTGAGGAAGCTGG - Intronic
963042664 3:141080944-141080966 CACAGAGCAAGTGGGCAAGCTGG - Intronic
963838002 3:150076485-150076507 CTAAGAGCAAGTGTGCAAGGAGG - Intergenic
964301820 3:155296234-155296256 CTTACAGCAACTGGGGGAGCTGG + Intergenic
965199966 3:165645467-165645489 CTCAGAGCAAGCGAGAGAGCAGG - Intergenic
965240113 3:166186341-166186363 GTAAGAGCAAGTGAGAAAGAGGG + Intergenic
966495054 3:180570667-180570689 CTTTGAGGAACTGAGGAAGGAGG + Intergenic
966583567 3:181596092-181596114 CTGACAGCAGGTGAGGAAACTGG + Intergenic
968826905 4:2905143-2905165 CGTAGAGCAAGTTGGGTAGCTGG + Intronic
970328916 4:14958709-14958731 CTAACAACAAATGAGGAAGCAGG + Intergenic
971524281 4:27596615-27596637 CATAGAACAAGTGACTAAGCTGG - Intergenic
972967482 4:44529356-44529378 CTTAGAGGGAAGGAGGAAGCAGG - Intergenic
973301573 4:48591049-48591071 CTTAGAGACAATAAGGAAGCTGG - Intronic
974602622 4:64105066-64105088 GTGAGAGCAAGTGAGGTAGGGGG + Intergenic
975842081 4:78485730-78485752 CAGAGAGAAAGTGATGAAGCTGG + Intronic
976087318 4:81419692-81419714 CATAGAGCATGTTAGGAAGTAGG + Intergenic
977700936 4:100021967-100021989 ATGGGAGCAAGTGAAGAAGCAGG - Intergenic
977969208 4:103193095-103193117 CTTAGAGTAAGTGGGTAGGCTGG + Intronic
980449712 4:132954998-132955020 CATAGAGCAATTAATGAAGCGGG + Intergenic
982019333 4:151188028-151188050 AGAAGAGCAAGAGAGGAAGCAGG - Intronic
982349446 4:154398966-154398988 CTTAGACCTAGTGAGAAGGCGGG - Intronic
984241199 4:177221306-177221328 CTAAGTGCAATGGAGGAAGCTGG + Intergenic
984432454 4:179665788-179665810 CATAGAGTAACTGAAGAAGCAGG - Intergenic
986995545 5:13602980-13603002 CTTAGAGGAAGGGAGGCAGGAGG + Intergenic
990607439 5:57424346-57424368 CTTCCAGGAAGTGAGGAAACTGG - Intergenic
998075203 5:139230678-139230700 CTCAGAGCATGTGAGGAACGTGG + Intronic
998754341 5:145359630-145359652 CTTGGAGCAAGTTAAAAAGCTGG + Intergenic
999177628 5:149642510-149642532 CTGAGAGGAAGAGAGGAATCAGG - Intergenic
1000842743 5:166242183-166242205 CTTAGAGCAAGTTAAGCAGATGG + Intergenic
1001237506 5:170042565-170042587 CATAGAGCACGTGAGCAAGAGGG - Intronic
1001778421 5:174346711-174346733 CGGAGAGCAAGTGGGGAGGCAGG - Intergenic
1002388188 5:178886895-178886917 CTTAGAGAAAATGAGTCAGCAGG - Intronic
1002766654 6:246185-246207 CTTAGAGCAAGTGAGACTGTAGG - Intergenic
1003394807 6:5743999-5744021 CTTAGACCTGGTGAGAAAGCTGG - Intronic
1003480735 6:6530213-6530235 CTCAGAGCAAGTGACAGAGCAGG + Intergenic
1003929233 6:10907455-10907477 CTTAGAGCAAGTGCTAAATCTGG + Intronic
1003944873 6:11065682-11065704 CTGTGAGGGAGTGAGGAAGCAGG - Intergenic
1004414302 6:15411132-15411154 CTAAGAAAAAGTCAGGAAGCTGG - Intronic
1004873508 6:19931841-19931863 AGTAGAGCAAGGGAGAAAGCAGG + Intergenic
1004984190 6:21061934-21061956 CTGATAGCAAGGGAGGAGGCAGG - Intronic
1007558625 6:42787016-42787038 TTTAGAGGAAGAGAGGAAACAGG + Intronic
1007948745 6:45850613-45850635 CATAGACCAGGTTAGGAAGCAGG + Intergenic
1009366493 6:62861248-62861270 GTTAGAGCCAGTGGGGAAGAAGG + Intergenic
1009452012 6:63812319-63812341 CTTGAAGGAAGTGAGGGAGCAGG - Intronic
1011400016 6:86950674-86950696 TTTAGAGCCAGTGATGAAGCAGG - Intronic
1011706151 6:90003344-90003366 CCTGGAGCAGGTGAGGGAGCTGG - Intronic
1014028589 6:116676403-116676425 CTTATAGGAAGTGCAGAAGCTGG - Intergenic
1014538043 6:122639988-122640010 CTAAGAGTAAGTGACAAAGCTGG - Intronic
1015590037 6:134814345-134814367 CTGGAAGGAAGTGAGGAAGCAGG + Intergenic
1017326692 6:153149223-153149245 CATATGGCAAGAGAGGAAGCAGG + Intergenic
1017490854 6:154943913-154943935 CTTAGAGCCAGTGAAGAGTCAGG + Intronic
1017767533 6:157618943-157618965 CCTTGAGCGAGTGAGGAAGAAGG - Intronic
1018285220 6:162230480-162230502 AGTGGAGCAAGTGAGGAAGTTGG - Intronic
1018638422 6:165885052-165885074 CGTAGACCAAGTAAGGAAGCCGG + Intronic
1022221078 7:28314383-28314405 CTTGGAGCAAGTGATGAAGATGG - Intronic
1023138804 7:37080692-37080714 CTTTGAGAAGGTGAGGAAGGTGG - Intronic
1024517413 7:50270695-50270717 CTGAGAGCCAATGAGGAAACAGG + Intergenic
1026848533 7:73710940-73710962 CTGAGAAAAAGTGGGGAAGCAGG + Intronic
1028516955 7:91688261-91688283 CTGGTAGAAAGTGAGGAAGCAGG + Intergenic
1030882877 7:114903174-114903196 ATCAGAGCAAGTGAGAAAGTGGG - Intergenic
1034474724 7:151275772-151275794 CTTCCAGCAAGGAAGGAAGCAGG - Intronic
1035131351 7:156656922-156656944 CTTAGACCAAATGAAGAAGAAGG - Intronic
1036198434 8:6744696-6744718 TTTAGAGCGAGTGAGGAGGAGGG - Intronic
1039821700 8:41140810-41140832 CACAGGGCAAGAGAGGAAGCAGG + Intergenic
1040994339 8:53387097-53387119 CTTAGAGCACGGAAGGGAGCAGG - Intergenic
1041729555 8:61050949-61050971 CTTAGAGCAAGTGAGCAGCTTGG + Intergenic
1043440855 8:80276069-80276091 CTGAGAGCTAGTTAGAAAGCAGG + Intergenic
1044215462 8:89604321-89604343 CCTAGAGCCAGAGATGAAGCTGG + Intergenic
1047409811 8:124615180-124615202 GTTAGAGCAAGAGAGGCAGGAGG + Intronic
1047421102 8:124709076-124709098 CTTAGAGGAAGTAAGAAAGGAGG + Intronic
1048006419 8:130422809-130422831 CTTGGAGCAAGCCAGTAAGCAGG + Intronic
1048161909 8:132029133-132029155 CCTAGAGCAAGTGAGAAGGCTGG - Exonic
1048628283 8:136211556-136211578 GTTAGACCATGTGAGGATGCAGG + Intergenic
1050100458 9:2113750-2113772 AATAGAACAGGTGAGGAAGCAGG - Intronic
1051454318 9:17236519-17236541 CCTGGAGAAATTGAGGAAGCAGG + Exonic
1053802299 9:41772078-41772100 CTTAGCGTCAGGGAGGAAGCTGG - Intergenic
1054142987 9:61543262-61543284 CTTAGCGTCAGGGAGGAAGCTGG + Intergenic
1054462692 9:65474143-65474165 CTTAGCGTCAGGGAGGAAGCTGG + Intergenic
1054647784 9:67604353-67604375 CTTAGCGTCAGGGAGGAAGCTGG + Intergenic
1055330844 9:75181898-75181920 CTGACAGCCAGTAAGGAAGCCGG + Intergenic
1056489471 9:87091082-87091104 CAGAGAGCAAGAGAGGAAGAAGG - Intergenic
1056628606 9:88274526-88274548 CTTAGGACAAGGGAGGAAGTTGG - Intergenic
1057025702 9:91732738-91732760 CGTCGGGCAAGTTAGGAAGCTGG + Intronic
1057401223 9:94725492-94725514 CTTGGAGAAAGTGAGAAAGTAGG - Intergenic
1057450067 9:95150418-95150440 CTGAGAGAAAGGGAGGAATCAGG - Intronic
1058100139 9:100910262-100910284 CATAAAGGAAGAGAGGAAGCTGG - Intergenic
1058208668 9:102139589-102139611 CTCTGAGCAAGGGAGGAAACTGG - Intergenic
1058633100 9:107009398-107009420 CTAAGAAAAAGTGAGGAATCTGG + Intronic
1059148629 9:111926487-111926509 CTTAGAGCAGGTGAGTATGGTGG + Exonic
1059295828 9:113269560-113269582 TTTAGAGTAACTTAGGAAGCAGG - Intronic
1059730291 9:117050457-117050479 CTGGGAGCAGGGGAGGAAGCAGG - Intronic
1061344715 9:130013856-130013878 CTTAGGGCAAGAGAGCAAGAGGG - Intronic
1061715701 9:132517604-132517626 CTTGGCGGAAGAGAGGAAGCTGG - Intronic
1061764599 9:132873856-132873878 CTAAGAGCAGGTGATGAATCTGG + Intronic
1186210698 X:7247620-7247642 ATTACAGCAAAAGAGGAAGCTGG - Intronic
1187092008 X:16106818-16106840 CCTAGGGCAACTGAGGAAGGTGG - Intergenic
1189876837 X:45444962-45444984 CTCATAGCAAGTGAGCCAGCTGG + Intergenic
1189974567 X:46448260-46448282 CTGAGACTAAGTGAGGAAGCTGG - Exonic
1190103747 X:47543587-47543609 ATTTTAGCAAGTGAGGAATCTGG - Intergenic
1190974355 X:55385257-55385279 CCTGGAGGAAGTGAGGAAGCAGG + Intergenic
1190989054 X:55526952-55526974 CTAAGAGTAAGTGATGCAGCGGG - Intergenic
1196131965 X:112166520-112166542 GCTAGAGGAAGTGAGAAAGCAGG + Intergenic
1196463457 X:115951310-115951332 GACAGAGCAAGAGAGGAAGCGGG - Intergenic
1196653077 X:118188566-118188588 TTCAGAGCAACTGAGGCAGCAGG - Intergenic
1198502241 X:137262268-137262290 CATAGAGCAAGTCAGCAGGCTGG - Intergenic
1200241824 X:154500189-154500211 CTTAATACAAGTGAAGAAGCTGG + Intergenic
1200683692 Y:6242815-6242837 CTCAGGGCAAGGGAGGGAGCTGG + Intergenic
1201048943 Y:9911571-9911593 CTCAGGGCAAGGGAGGGAGCTGG - Intergenic