ID: 1064350274

View in Genome Browser
Species Human (GRCh38)
Location 10:14569830-14569852
Sequence AGATGGACAGAGAGCTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064350266_1064350274 19 Left 1064350266 10:14569788-14569810 CCGTGCTTCCCCAAACAAGATCT 0: 1
1: 0
2: 1
3: 17
4: 230
Right 1064350274 10:14569830-14569852 AGATGGACAGAGAGCTTCACAGG No data
1064350270_1064350274 10 Left 1064350270 10:14569797-14569819 CCCAAACAAGATCTGGGACTCTC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1064350274 10:14569830-14569852 AGATGGACAGAGAGCTTCACAGG No data
1064350271_1064350274 9 Left 1064350271 10:14569798-14569820 CCAAACAAGATCTGGGACTCTCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1064350274 10:14569830-14569852 AGATGGACAGAGAGCTTCACAGG No data
1064350269_1064350274 11 Left 1064350269 10:14569796-14569818 CCCCAAACAAGATCTGGGACTCT 0: 1
1: 0
2: 2
3: 13
4: 147
Right 1064350274 10:14569830-14569852 AGATGGACAGAGAGCTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064350274 Original CRISPR AGATGGACAGAGAGCTTCAC AGG Intronic
No off target data available for this crispr