ID: 1064354286

View in Genome Browser
Species Human (GRCh38)
Location 10:14603992-14604014
Sequence TGCGGGGGGCGCCGCGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 452}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064354286_1064354309 30 Left 1064354286 10:14603992-14604014 CCGCCTCCGCGGCGCCCCCCGCA 0: 1
1: 0
2: 3
3: 43
4: 452
Right 1064354309 10:14604045-14604067 GGCACCTCCCGGGCGCCGCGCGG No data
1064354286_1064354303 19 Left 1064354286 10:14603992-14604014 CCGCCTCCGCGGCGCCCCCCGCA 0: 1
1: 0
2: 3
3: 43
4: 452
Right 1064354303 10:14604034-14604056 CCCTGAGCCCCGGCACCTCCCGG No data
1064354286_1064354305 20 Left 1064354286 10:14603992-14604014 CCGCCTCCGCGGCGCCCCCCGCA 0: 1
1: 0
2: 3
3: 43
4: 452
Right 1064354305 10:14604035-14604057 CCTGAGCCCCGGCACCTCCCGGG No data
1064354286_1064354299 9 Left 1064354286 10:14603992-14604014 CCGCCTCCGCGGCGCCCCCCGCA 0: 1
1: 0
2: 3
3: 43
4: 452
Right 1064354299 10:14604024-14604046 CGCGTGCCCGCCCTGAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064354286 Original CRISPR TGCGGGGGGCGCCGCGGAGG CGG (reversed) Intronic
900087324 1:904736-904758 TGCGCCGGGCGCTGCGGAAGCGG - Intergenic
900162796 1:1232289-1232311 TGCGGCGGGCGTGGCGGCGGCGG + Exonic
900513131 1:3069590-3069612 CGCGGTGGGGGCCGGGGAGGGGG + Intronic
900589797 1:3454573-3454595 GGCGGGGAGGGCCGGGGAGGGGG - Exonic
900936449 1:5769163-5769185 TGTGGGGAGGGCCGGGGAGGTGG - Intergenic
901457510 1:9371624-9371646 TGCCGGGGGAGCTGGGGAGGGGG + Intergenic
901673064 1:10867196-10867218 TGCGGGCTGCGCCGCGGAGCGGG - Intergenic
901791343 1:11654971-11654993 CGCGGGGGGCGCTGGGGAGGGGG + Intronic
903349882 1:22711112-22711134 TGCGGGCCGCGGAGCGGAGGTGG - Intronic
903362343 1:22784499-22784521 TGCGGTGGGCGCCACGGCGCCGG - Exonic
903907410 1:26696505-26696527 GGCGGGGGGCGAGGCGGCGGCGG + Exonic
904006596 1:27366329-27366351 TGCGGGGGCGGCCGCGGCCGGGG + Exonic
904618081 1:31760686-31760708 GGCGGCGAGCGCCGGGGAGGCGG - Intronic
905107740 1:35574192-35574214 TGCGCGGGGCGCGGCCCAGGCGG - Exonic
905414169 1:37793606-37793628 TGCCTGGGGTGCCGGGGAGGGGG + Intergenic
906633192 1:47389686-47389708 TGGGGGGGGCGGCGTGGTGGGGG - Intergenic
907767355 1:57424142-57424164 CGCGGGGGGCGGCGGGGCGGGGG - Intronic
907850495 1:58250363-58250385 CGCGGGAGACGCCGCGGAGCTGG + Intronic
910758862 1:90716816-90716838 TGCTGGGGGGGCGGCGGCGGCGG + Exonic
910981245 1:92961550-92961572 CGCGGCGCGCGCCGCGGCGGGGG - Intergenic
911664635 1:100539253-100539275 TGCGGGGGGCTCCGCAGAGCCGG - Exonic
912633598 1:111270810-111270832 GGCCGGGGGCGCAGCGGGGGCGG - Intergenic
912717004 1:111989959-111989981 TGGTGGGGGCGCGGCGCAGGCGG + Intergenic
912800148 1:112715188-112715210 GGCGGCGGGCGGCGCCGAGGCGG + Exonic
913300514 1:117365535-117365557 TGGGGGGGGCGGTGGGGAGGCGG - Intergenic
914373372 1:147050739-147050761 GGCGGGGAGGGCAGCGGAGGAGG + Intergenic
915127920 1:153678885-153678907 CGCGCAGGGCGCCGCGGAGCAGG - Exonic
915172096 1:153985452-153985474 TGCTGGGGGCCCCTGGGAGGAGG + Intronic
915463176 1:156081708-156081730 TGCGGGGGCCGCCGTCGGGGCGG + Exonic
915513656 1:156400676-156400698 TGCGGGGGGCGCGGGGGCTGGGG + Intergenic
915953498 1:160205432-160205454 GGCGGCGGGAGCCGAGGAGGAGG + Exonic
920135988 1:203769771-203769793 TGCGGGGGGGGGGGCGGCGGGGG + Intronic
920309965 1:205043236-205043258 TGCGGCGGCGGCCGCGGCGGCGG - Exonic
920461716 1:206145682-206145704 TGCAGGGAGCGGGGCGGAGGGGG + Intergenic
920528438 1:206685143-206685165 GTCGGGGGGCGGCGGGGAGGGGG + Exonic
920886867 1:209938116-209938138 CGCGAGGGGCGCCGCGGGCGGGG - Intergenic
921390568 1:214609184-214609206 TTCGGGGGGAGCTGCGGCGGTGG - Intronic
922440804 1:225653490-225653512 AGCGGGAGGCGACGGGGAGGGGG - Intergenic
922513142 1:226186462-226186484 GGCTGGGGGCGCGGCGGAGGAGG - Exonic
922925308 1:229342711-229342733 CGAGGGGCGCGCCGCCGAGGAGG + Intronic
923506465 1:234609787-234609809 GGCGGCGGGCGCGGCGGTGGGGG + Intergenic
924325453 1:242890508-242890530 CGCAGGGAGAGCCGCGGAGGCGG + Intergenic
1064028806 10:11869992-11870014 CGCGGGGGACGCCGGCGAGGGGG + Exonic
1064244314 10:13657140-13657162 TGCGGGGGGCGCGGGGGGCGCGG - Exonic
1064342744 10:14501380-14501402 TGGGGGGGGTGTCGGGGAGGGGG - Intergenic
1064354286 10:14603992-14604014 TGCGGGGGGCGCCGCGGAGGCGG - Intronic
1065188924 10:23193227-23193249 TGCGGGGGGCCGGGCGGCGGCGG + Exonic
1066022913 10:31320081-31320103 AGCGGGAGGCGCCAGGGAGGAGG - Intronic
1066080713 10:31928544-31928566 TGCGGGAGGCGCGGCGGCGGCGG - Intronic
1067474561 10:46557045-46557067 TGCGGGGCGTGGTGCGGAGGGGG - Intergenic
1067481127 10:46598195-46598217 CGCGAGGGGAGCCGCGGAAGGGG + Intergenic
1067613625 10:47743627-47743649 CGCGAGGGGAGCCGCGGAAGGGG - Intergenic
1067980032 10:51074295-51074317 CGCGGTGGGCGCCGCGGCGCGGG - Exonic
1069664630 10:70146286-70146308 TCCCGGGGGCGGCGCGGAGCGGG - Exonic
1071629033 10:87203599-87203621 CGCGAGGGGAGCCGCGGAAGGGG - Intergenic
1071847623 10:89536025-89536047 GGCGAGGGGCGCAGCGGAGGAGG + Intronic
1072221586 10:93331694-93331716 TGCGGGGGGCGTAGGGGGGGTGG + Intronic
1072982975 10:100115222-100115244 TGCGGCGGGCGCCCCGGACCCGG + Intergenic
1073063644 10:100746113-100746135 TGCGGGGCGCGCGGGGGCGGGGG - Exonic
1073099598 10:100999781-100999803 GGCCGGGGGCGCCGCGGAGGCGG + Exonic
1074776589 10:116771855-116771877 TGCTGGGGGCGGTGGGGAGGTGG + Intergenic
1074865454 10:117542229-117542251 TCAGGGGGCCGCAGCGGAGGCGG + Intergenic
1075040688 10:119104536-119104558 TGCGAGGGGCGCTGCGCGGGCGG + Intronic
1076116968 10:127907454-127907476 TACTGGGCGCGCCGCGGGGGCGG - Intronic
1076149306 10:128149944-128149966 CGGAGGGGGCGCTGCGGAGGGGG - Intergenic
1076149311 10:128149958-128149980 GGCTGGGGGCACTGCGGAGGGGG - Intergenic
1076163712 10:128265918-128265940 TGCGGGGGGCGCGGGGTAGAGGG + Intergenic
1076566138 10:131400733-131400755 TGCCTGGGCCACCGCGGAGGCGG + Intergenic
1077008314 11:369373-369395 CGCGGGGTGCGGGGCGGAGGAGG - Intergenic
1077192591 11:1261685-1261707 GCCGGGGGGCTCCGCAGAGGAGG - Exonic
1077253754 11:1571812-1571834 GGCGGAGGGCGCCGCGTCGGGGG - Intronic
1077285609 11:1763988-1764010 TGCGCGGGGCGGGGCGGAGCGGG + Exonic
1077674966 11:4187447-4187469 TGCGGCGGCCGCGGCGGCGGCGG + Intergenic
1077987192 11:7365049-7365071 TGCGGGGTGGGCCTGGGAGGAGG - Intronic
1078660173 11:13279056-13279078 TGCGGGGTGCGCGGCGGCAGCGG - Intronic
1081528399 11:43942469-43942491 GGCGGGCGGCGCCGGGGAAGGGG + Exonic
1081699973 11:45146804-45146826 GGCGGGCGGCTCGGCGGAGGCGG - Intronic
1081805021 11:45885773-45885795 GGCGGAGCGCGGCGCGGAGGAGG - Exonic
1081831626 11:46120437-46120459 TGCCGGGGGCGGCGGGGAGGGGG - Intronic
1082816805 11:57514753-57514775 TGAGGGGCGCGCGGGGGAGGAGG - Intronic
1083599741 11:63939312-63939334 CGCTGGGGGCGCCGAGGGGGTGG - Intronic
1083659754 11:64246634-64246656 CGCGGGGGGCGCGGCGTTGGCGG - Exonic
1083920894 11:65780987-65781009 GGCGGGGCGCGGCGCGGGGGCGG + Intergenic
1084257936 11:67955429-67955451 TGCCGGGGGTGCCGGGGACGCGG - Intergenic
1084295912 11:68213390-68213412 CGCGGGGGGCGCGACGGCGGCGG - Exonic
1085197963 11:74683642-74683664 CGCGGTGGGGGCCGCGGTGGGGG - Intergenic
1087672750 11:101127541-101127563 CGCGGGGGCCGCCCCGGCGGCGG + Exonic
1089543622 11:119206170-119206192 GGCGGGGCGCGTCCCGGAGGCGG - Exonic
1089943190 11:122440728-122440750 TGTGGGGGGAGCGGAGGAGGGGG - Intergenic
1091550058 12:1530294-1530316 CGCGGGAGGCGGGGCGGAGGCGG + Intronic
1091915740 12:4271096-4271118 TGCAGAGGGCGCCGGGAAGGGGG + Intergenic
1093464987 12:19439886-19439908 AGCGGTGGGGGCGGCGGAGGCGG + Exonic
1093844299 12:23949889-23949911 AGCGTGTGGCTCCGCGGAGGGGG - Intronic
1094041110 12:26122617-26122639 CCCGGGGGGCGGCGCGGCGGCGG - Exonic
1094486085 12:30926867-30926889 GGCGGGGCGGGCAGCGGAGGTGG - Intronic
1095440799 12:42237798-42237820 GGCGGGGGGCGGGGCGGGGGCGG - Intronic
1095917613 12:47495983-47496005 TGGGGGGTGGGCGGCGGAGGGGG - Intergenic
1096495468 12:52037187-52037209 GGCGGGGGGCGCCGCGCGGCCGG + Intronic
1096647593 12:53047190-53047212 GGCGCGGGGCGCGGCGGGGGCGG + Intronic
1096691651 12:53325413-53325435 GGCGGGGGGCGCCTTGGAGCTGG - Intergenic
1096716208 12:53493045-53493067 TGGGGCGGGGGCCGCGGCGGCGG + Intronic
1097155060 12:57006405-57006427 TGCTCGGGGCGCCGCAGAGCCGG - Exonic
1098416776 12:70243513-70243535 AGCGGGGCGCGCGGCGGGGGCGG + Intronic
1100611499 12:96194804-96194826 GGCGGGGGGCGCCGCGGGGTGGG + Intronic
1100800008 12:98221294-98221316 TGGGGGGCGGGCGGCGGAGGGGG - Intergenic
1101131725 12:101697597-101697619 GGCTGGGGGCGGGGCGGAGGGGG - Intronic
1102453293 12:113056874-113056896 TCCGGGGGGAGCCCAGGAGGCGG + Intronic
1102677559 12:114668862-114668884 GGCGGGGTGCGCTGCGGGGGTGG - Intergenic
1102812677 12:115837974-115837996 TGTGGGGGGCGCTGCCCAGGAGG - Intergenic
1103308920 12:119989325-119989347 TGCTGGGGCTGCCGCGGAGCCGG + Intergenic
1104173907 12:126310310-126310332 TGGGGGGGGCGCATGGGAGGAGG - Intergenic
1104376335 12:128267577-128267599 TGCGGCGGGGGCCTCGGCGGGGG + Intronic
1104581450 12:130014060-130014082 CGAGCGGGGCGCTGCGGAGGAGG + Intergenic
1104957786 12:132474765-132474787 GGCGGGGGTCACCGCGGAGGAGG - Intergenic
1104957816 12:132474835-132474857 GGCGGGGGTCACCGCGGAGGAGG - Intergenic
1105409726 13:20161381-20161403 TGCGGTGGGCGCCCCGCAAGCGG - Intergenic
1105472303 13:20704418-20704440 GGGGCGGGGCGACGCGGAGGGGG + Intronic
1106269486 13:28139102-28139124 GGCGGGGCGGGCCGCGGCGGCGG + Intronic
1106452427 13:29895058-29895080 GGCGGGGGGCGGGGGGGAGGTGG + Intergenic
1108596842 13:51956565-51956587 AGCGGGAGGTGCCACGGAGGAGG + Intronic
1112580784 13:100674858-100674880 TGCGGGAGGCGCGGCGCGGGGGG - Intronic
1113378817 13:109785571-109785593 CGCGGCGGGCGCGGCGGCGGGGG + Exonic
1113779757 13:112969278-112969300 CGGAGGGGGCGCGGCGGAGGCGG - Exonic
1113841259 13:113363084-113363106 AGCCTGGGGCGCCCCGGAGGAGG + Intronic
1113933162 13:113979162-113979184 TGCGGAGGGCGTGGCGGTGGTGG + Exonic
1117377448 14:55129307-55129329 TGCGCGGGGCGCGGGGGACGCGG + Intronic
1117478260 14:56118600-56118622 GGCGGGGATCGCGGCGGAGGCGG + Exonic
1117690337 14:58299183-58299205 GGCGGGGGGCGGAGGGGAGGAGG - Intronic
1118289203 14:64504519-64504541 CGCGGGGGCCGTCGCGGCGGCGG - Intronic
1119106867 14:71932774-71932796 TGTGGGGAGCGGCGCGGAGACGG + Exonic
1119622125 14:76138967-76138989 CGCGGGGGGCGGCGCGGCGCCGG + Intergenic
1122066006 14:99174936-99174958 TGCGGCGGGCGGCGGGGACGCGG - Exonic
1122143031 14:99673814-99673836 TGAGGGGGGCGGCATGGAGGGGG + Intronic
1122220980 14:100239076-100239098 AGGGGCGGGCGCCGCGGCGGCGG - Exonic
1122402095 14:101473592-101473614 TGGGAGGGGAGCTGCGGAGGAGG - Intergenic
1122722434 14:103729858-103729880 TGCGGGGAGCCCCGGTGAGGAGG - Intronic
1122768184 14:104085581-104085603 GGTGGGAGGCCCCGCGGAGGCGG - Intergenic
1122864431 14:104597165-104597187 GGCGGGGGTCGCCTGGGAGGTGG - Intronic
1122917237 14:104864960-104864982 AGCGGGGGGCGCTGCCGAGACGG + Intergenic
1123036716 14:105474689-105474711 GCCTGGGGGCGCCGCGGGGGCGG - Intronic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1124500347 15:30223034-30223056 TTGGGGGGGCGCGGCGGCGGCGG - Intergenic
1124743226 15:32315632-32315654 TTGGGGGGGCGCGGCGGCGGCGG + Intergenic
1125674161 15:41493783-41493805 GGCGGGGGGCGCGGCCGAGGCGG + Intronic
1126113287 15:45187758-45187780 CGCGGGGGGGGCGGCGGCGGAGG - Intronic
1126766911 15:52019077-52019099 GGCTGCGCGCGCCGCGGAGGCGG - Intronic
1126766988 15:52019398-52019420 TGCGGGGTGCGCCGGCGGGGCGG + Intronic
1127165543 15:56243029-56243051 GGCGGGGGGAGCGGAGGAGGAGG - Intronic
1127225163 15:56919592-56919614 AGCAGGGGGCGCCGAGGAGGTGG + Intronic
1127286458 15:57538000-57538022 GGCGGGGGGTGGCGGGGAGGAGG - Intronic
1128547790 15:68579339-68579361 TGCGGGGGGCGCGGGGGTGTGGG + Intronic
1128651171 15:69414672-69414694 GGCGGGGGGCGACGCGGCAGGGG - Intronic
1129037937 15:72662258-72662280 TGCTGGGGGCGCCAGGGATGGGG - Exonic
1129211952 15:74074973-74074995 TGCTGGGGGCGCCAGGGATGGGG + Exonic
1129475594 15:75782826-75782848 TGCTGGGGGTGCCGGGGATGGGG - Intergenic
1129710911 15:77819859-77819881 GGGCGGCGGCGCCGCGGAGGGGG - Intronic
1131827374 15:96332044-96332066 TGCGGGCGGCGGCGGGGCGGCGG - Exonic
1132464814 16:72538-72560 TCCTGAGGGCGCCGGGGAGGAGG + Exonic
1132487665 16:203708-203730 GGCGGGGGGCGGGGTGGAGGTGG + Intronic
1132522216 16:397109-397131 GGCGGGGGGCTCCGGGGCGGCGG + Intronic
1132552912 16:560667-560689 AGCGGCGGGAGCCGCGGGGGCGG + Intronic
1132579938 16:680178-680200 TGTGGCGGCCGCCGCCGAGGCGG + Intronic
1132627143 16:896682-896704 TGCGGGGGGAGCAGTGGCGGTGG - Intronic
1132694514 16:1195905-1195927 TGCTGGGGGCGGGGCCGAGGGGG - Exonic
1132742323 16:1420979-1421001 AGAGGCGGGCGCCGCGGGGGCGG + Intergenic
1132847835 16:2008899-2008921 GGCGGGGGGCGGCGGCGAGGAGG + Intronic
1132885097 16:2179027-2179049 GGCGGGGGGCGCGGCGGCGGCGG + Exonic
1132889398 16:2196538-2196560 GGCGGCGGGCGGCGAGGAGGCGG - Intergenic
1132889442 16:2196630-2196652 GGCGGGGGGCGGCCCGGGGGCGG + Intergenic
1133156560 16:3880452-3880474 TGGGGGGGCCGCGGCGGCGGCGG - Exonic
1135480090 16:22814751-22814773 AGCGAGGCGCGCCGAGGAGGCGG - Exonic
1135994224 16:27236133-27236155 TGCCGGGGGCTCAGCTGAGGAGG + Intronic
1136428180 16:30183176-30183198 CGCGGGGGGCGCGGGCGAGGAGG - Intronic
1136458471 16:30395536-30395558 TCCGGAGGGCGCCGGGGTGGCGG + Exonic
1136512708 16:30748789-30748811 GGCGGGGGCCTGCGCGGAGGAGG - Exonic
1138398888 16:56730010-56730032 GGCCGGGGGCGGGGCGGAGGTGG - Intronic
1139451314 16:67029674-67029696 CGCGGGCGGCGCCGCGGATTTGG + Intronic
1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG + Exonic
1139664511 16:68447087-68447109 GGCGGGGGGCGCGGCCGCGGAGG - Intronic
1139846463 16:69924880-69924902 TGGGGGGGACGCCGAGGTGGAGG + Intronic
1140529036 16:75648236-75648258 GGCCGAGGGCGCCGCGGAGCCGG + Exonic
1141054502 16:80803666-80803688 GGCCGGGGGCGCGGGGGAGGAGG - Intronic
1141430903 16:83969660-83969682 TTCAGGGGGCGGCTCGGAGGAGG + Intronic
1142006132 16:87690363-87690385 CACGGCGGGCTCCGCGGAGGAGG - Exonic
1142209848 16:88803867-88803889 TGCGGGGGGGCCCGGGGCGGCGG - Exonic
1142623754 17:1179987-1180009 CGCGGGGGGCGGGGCGGGGGTGG + Intronic
1143037817 17:4009759-4009781 TGCAGGAGGAGCCCCGGAGGTGG + Intronic
1143099869 17:4499074-4499096 GGCGGCGGGCGGCGCGGAGGAGG + Exonic
1143099870 17:4499077-4499099 GGCGGGCGGCGCGGAGGAGGAGG + Exonic
1143484012 17:7243094-7243116 TTGGGAGGGCGCCGGGGAGGCGG + Intronic
1144608330 17:16687347-16687369 TGCGGGGGGCGGCGGGGGAGGGG - Intergenic
1145196514 17:20898916-20898938 TGCGGGGGGCGGGGGGGAGGGGG + Intergenic
1146276172 17:31517189-31517211 TGCGGGGGGGGGGGCGGTGGGGG + Intronic
1147123890 17:38352500-38352522 TGCGGAGGGGGCGGCTGAGGAGG - Exonic
1147159321 17:38561405-38561427 TGGGGGGTGCGCTGCGGAGAGGG - Intronic
1147314395 17:39612665-39612687 TGCGGCGGGCGGGGAGGAGGGGG - Intergenic
1147685940 17:42287023-42287045 TGCAGGGGGCCCCAGGGAGGAGG - Intergenic
1147741646 17:42673804-42673826 TACCGGGAGCCCCGCGGAGGAGG - Exonic
1147793042 17:43025180-43025202 GGCTGGGGGCGGGGCGGAGGGGG + Intergenic
1148493478 17:48037834-48037856 GCCGCGGGGCGGCGCGGAGGCGG - Intronic
1148664077 17:49361852-49361874 TGCCGGGGGCGCCGCCGCGGCGG + Intronic
1149595344 17:57861835-57861857 GGCGCGGGGAGCAGCGGAGGGGG + Exonic
1150268918 17:63849885-63849907 TGCGGGGGGTGCTGCGGTGAGGG + Intergenic
1151425974 17:74031401-74031423 GGCGGTGGGCGGCGGGGAGGGGG - Intergenic
1152362541 17:79839352-79839374 TGCGGGGCGAGCGGCGGCGGCGG - Exonic
1152527714 17:80898696-80898718 TGCGGGGGGAGCCGGGGCGGGGG - Intronic
1152607751 17:81301596-81301618 GGCGGTGGGAGCCGCGGAGCCGG - Intergenic
1152711198 17:81871200-81871222 GGCGGGGGGCGCTGAGGTGGGGG - Intronic
1152721882 17:81927473-81927495 TGGGGGCGGCGCGGCGGGGGCGG - Intronic
1152782997 17:82234650-82234672 TGCGGGGAGGGCCCGGGAGGAGG + Exonic
1152784033 17:82238835-82238857 TGAGGTGGCGGCCGCGGAGGAGG + Exonic
1152870835 17:82752217-82752239 CGCGGGCGGCCCCGAGGAGGAGG + Exonic
1153051817 18:907739-907761 GGCGGCGCGCGGCGCGGAGGCGG - Exonic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1153959952 18:10132102-10132124 TGTGGGGGCCGCGGCGGAGCGGG - Intergenic
1154172220 18:12060541-12060563 TGCGGGGGGCGGTGGGGGGGTGG + Intergenic
1154416346 18:14177910-14177932 TGCCGGCGGCGCCGGGGTGGGGG + Intergenic
1156008565 18:32470932-32470954 AGCGGGCGGCGCCTGGGAGGCGG - Intergenic
1156350431 18:36297659-36297681 CGCGGGGGGCGGGGCGGGGGCGG - Intergenic
1157384092 18:47247583-47247605 TGCGGGGGCTGCCCCGGCGGGGG + Intronic
1157706799 18:49813960-49813982 TGGGCGGGGCGCGGCGGCGGCGG + Exonic
1157752874 18:50194476-50194498 TGAGGGGCGCGGCGGGGAGGGGG + Intronic
1158453359 18:57586399-57586421 GGCGAGGGGCGTCGCGGAGAAGG - Intronic
1160204761 18:76823044-76823066 CGCGGGGCGCGCTGGGGAGGCGG + Intronic
1160387535 18:78505587-78505609 TGCAGTGGGCGCAGAGGAGGTGG + Intergenic
1160738808 19:676601-676623 GTCGGGGGGCGCGGCGGCGGCGG + Intronic
1160775529 19:853418-853440 GGCGGGGGGCGCAGGGGCGGAGG + Intronic
1160853551 19:1206055-1206077 TCCGCGGGGCGGCGCGGCGGCGG - Intronic
1160991896 19:1863517-1863539 CGCGGCGGGCGGAGCGGAGGCGG + Exonic
1161072688 19:2270501-2270523 CGCGGGGGCCGCCGGGGAGCTGG + Intronic
1161111732 19:2474763-2474785 AGCGGTGGGCGGCGCGGAGGAGG + Intergenic
1161210221 19:3062049-3062071 TGGGGGGGGCGCCGGGCCGGAGG + Intronic
1161266414 19:3366691-3366713 TGCGGGGGGCGCGGGGGCGCCGG - Intronic
1161307775 19:3577278-3577300 TGCGGGGGTCGGGGAGGAGGCGG - Intronic
1161350086 19:3786427-3786449 GGCGCCGGGGGCCGCGGAGGCGG - Intronic
1161358200 19:3831463-3831485 TGCGGGGGTCCCGGGGGAGGCGG + Exonic
1161702825 19:5804619-5804641 TGAGGGGGGCGCCGCTCTGGGGG + Intergenic
1161719999 19:5897396-5897418 CGTGGGGGGCGCCGCTGAGCTGG - Intronic
1161920071 19:7259333-7259355 TGTGGGGTGCGCGGCGGAAGGGG + Intronic
1162033163 19:7925943-7925965 TGAGGGGCGCGCCGGGGCGGGGG - Intronic
1162315493 19:9936159-9936181 GGCGGGGGTCGCAGCGGGGGAGG - Intronic
1162562326 19:11423837-11423859 GGGGGGGGGCGCGGCGGAGAGGG + Intronic
1162948523 19:14057508-14057530 TCCGGTGAGCCCCGCGGAGGAGG - Intronic
1162948578 19:14057638-14057660 TGGGGGGGGCGGGGCGGGGGCGG + Intronic
1163681275 19:18683912-18683934 GGGGGGGGGCGCGGCGGGGGCGG + Intronic
1164594976 19:29526557-29526579 CGCGGGGGGCGCGGTGGCGGCGG - Exonic
1164693124 19:30225716-30225738 TGCGGGGGGCGCGGCGCGGGGGG + Intergenic
1165420077 19:35718106-35718128 GGCGGGGGCCGCGGCGGACGGGG + Exonic
1165423125 19:35732159-35732181 TGGGGGTGGAGCCGCGGAGGTGG + Intronic
1165559654 19:36668023-36668045 TGCGGGAGGAGCTGAGGAGGTGG - Intergenic
1166305688 19:41935854-41935876 TGGGGGGGGAGCCTGGGAGGGGG - Intergenic
1166321896 19:42023811-42023833 GGCAGGGGGCGCCGATGAGGCGG - Intronic
1166367247 19:42284016-42284038 GGCGGGGGGAGGCGCGGCGGGGG + Intronic
1166737260 19:45093408-45093430 GGCGGGGGGCGACGCGGGGCTGG - Exonic
1167040604 19:47020778-47020800 GGCGGGCGGCGCGGGGGAGGCGG + Intronic
1167648725 19:50718812-50718834 GGCGGGGGGCACCGGGGAGCAGG + Intronic
1167668446 19:50836387-50836409 TGCAGGGGGCGCCCAGGAGCAGG - Intronic
1168059569 19:53883362-53883384 TGGTGGGGCCACCGCGGAGGTGG + Intronic
1168072963 19:53962995-53963017 GGAGGGGGGCGGCGAGGAGGAGG - Intergenic
1168315163 19:55481894-55481916 GGGGGGCGGGGCCGCGGAGGCGG - Exonic
1168339124 19:55613808-55613830 TGCGGCGGGGGCTGCGGCGGGGG - Exonic
1168443674 19:56393466-56393488 TGCCGGGGGCGCGGCCGCGGTGG - Exonic
925610508 2:5697207-5697229 TGCGGCGCCCGCAGCGGAGGAGG + Exonic
926095772 2:10080067-10080089 CCCGGGGGCAGCCGCGGAGGAGG - Exonic
927900629 2:26815774-26815796 GGTGGGGGGCGCCGGGGCGGGGG + Intergenic
927917311 2:26945500-26945522 TGCGGGGGGGGACGGGGGGGCGG - Intronic
929537526 2:42792824-42792846 TGTGTGGGGCGCCCCGGAGACGG - Intergenic
930872827 2:56184940-56184962 AGCGGGGTGCCCCGAGGAGGAGG + Intronic
931253668 2:60553278-60553300 TGCGGGGCGGGCGGCGGCGGCGG + Exonic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
934763843 2:96869745-96869767 GGCGCGGGGAGCCGCGGCGGCGG - Intronic
935563655 2:104584323-104584345 GGGGGGGGGCGGCGGGGAGGGGG + Intergenic
935592498 2:104855411-104855433 GGCGGGGGGCGCGGCGGCGGCGG + Intergenic
936126711 2:109794606-109794628 GGCGGGGGGGGCGGCGGCGGCGG + Intronic
936555669 2:113496858-113496880 TGCCGGGGGCGCTGGGGAGGAGG + Intergenic
937132075 2:119521522-119521544 TGGGGGTGGGGCCGCAGAGGGGG + Intronic
938320079 2:130356503-130356525 TGGGGCGGGCGCCGCAGGGGAGG + Intronic
939173910 2:138727654-138727676 TGCGGGGGGCGGTGAGGCGGGGG + Intronic
941666330 2:168247200-168247222 TGCGGCGGGCGCGGCGGGGCCGG - Intronic
941808510 2:169733779-169733801 TGTGGGGGGCGCCGCTGGGGAGG + Intronic
941808724 2:169734444-169734466 TGCGGCGGGCGCGGGGGAGGGGG + Intronic
941819194 2:169827753-169827775 TCCGGGGGCGGCCGAGGAGGAGG + Exonic
941906164 2:170717050-170717072 GGCGGGCGGCGCCCCCGAGGCGG + Exonic
942311813 2:174663471-174663493 TGCAGGGGGCGGCGGGGTGGGGG - Intronic
945188945 2:207166618-207166640 TGGAGGGGGCGCGGCGCAGGGGG + Intronic
946306559 2:218859860-218859882 CGAGGAGGGCGCGGCGGAGGCGG - Exonic
947566654 2:231198562-231198584 CGCGCGGGGCGCCGCCGACGCGG - Exonic
947669551 2:231927537-231927559 TGCGGTGTGGGCCGCAGAGGCGG + Intergenic
947841306 2:233209562-233209584 TGGGGGGGGGGCTGCGGTGGAGG - Intergenic
948248676 2:236507610-236507632 TGCGGGGGGCGGGGGGGGGGAGG - Intergenic
1168766077 20:382030-382052 TGCGGGGGGCGGGGCGGGGTGGG + Intronic
1168800646 20:642037-642059 TGGGGGGGGCCCAGCGGGGGTGG + Intergenic
1168800675 20:642100-642122 TGGGGGGGGCCCAGCGGGGGTGG + Intergenic
1168800741 20:642230-642252 TGGGGGGGGCCCAGCGGGGGTGG + Intergenic
1169074019 20:2750607-2750629 TGCGGGGGGCTGCGCGATGGTGG - Intronic
1169092969 20:2872718-2872740 TGCCGGGAGCGCCGGGAAGGGGG + Intronic
1170578772 20:17682521-17682543 TGCGCGGGGCGGGGCGGAGCAGG + Intergenic
1171123709 20:22584900-22584922 AGTGCGGGGCGCCGCGGCGGTGG - Intronic
1171208948 20:23302419-23302441 GGCGGGGGGCGGCAGGGAGGGGG - Intergenic
1172277175 20:33686097-33686119 GGCGGCGGGCGCCGCGGGGCCGG + Exonic
1172292456 20:33785909-33785931 TGGGGGGGGCCCGGGGGAGGGGG - Intronic
1172446815 20:34997502-34997524 GGCGGAGGGCGCGGCGGAGCTGG + Exonic
1172662048 20:36574444-36574466 GGGGGGGGGCGGCGCGGAGGTGG + Intronic
1172892713 20:38278288-38278310 TGGCGGTGGCGCCACGGAGGGGG + Intronic
1173734305 20:45348481-45348503 TGCGGGCGGCGGGGCGGGGGCGG - Intergenic
1173807364 20:45934724-45934746 TGGGGAGGGCGAGGCGGAGGCGG + Exonic
1174045441 20:47729664-47729686 TGTGAGAGGCGCCGGGGAGGCGG + Intronic
1175859718 20:62143687-62143709 CGCGGGGGGCGCCGCGTCGTGGG - Intergenic
1175916243 20:62427333-62427355 TGCGAGGAGAGCCGCGGGGGTGG - Intronic
1176016805 20:62938119-62938141 GGTGGGGGCCGCGGCGGAGGCGG - Exonic
1176019339 20:62954569-62954591 TGCTGGGGGCGCGGGGGACGGGG - Intronic
1176050434 20:63116509-63116531 CGCGGGGGGAGCCGCAGAGCTGG + Intergenic
1176081055 20:63273148-63273170 GGCGGGGGGCGGCACGGCGGAGG - Intronic
1176856990 21:13981380-13981402 TGCCGGCGGCGCCGGGGTGGGGG - Intergenic
1176867607 21:14062843-14062865 TGCCGGCGGCGCCGGGGTGGGGG + Intergenic
1177819642 21:26016949-26016971 GGCGGGGGGTGCCGCCAAGGTGG + Intronic
1178839866 21:36130043-36130065 TGCGGGGAGCCCCGCGGCGGGGG + Intergenic
1178865103 21:36320417-36320439 TGCGGCGGGGCCCGGGGAGGGGG + Intronic
1179405336 21:41121217-41121239 TGCGGGTGGTGCGGGGGAGGGGG - Intergenic
1179675070 21:42975202-42975224 TGCGGGGCGCGCGGCGGCGCAGG + Intronic
1179798385 21:43798902-43798924 TGCTGGGGGCGGTGGGGAGGGGG - Intronic
1179947194 21:44686440-44686462 TGCGGGGGGCAGGGCGGGGGTGG - Intronic
1179976893 21:44873466-44873488 GGCGGGCGGGGCCGCGAAGGGGG - Intronic
1180951448 22:19722348-19722370 GGCGGCGGGGGCGGCGGAGGCGG + Intronic
1180997571 22:19973075-19973097 GGCTTGGGGAGCCGCGGAGGTGG - Intronic
1181571981 22:23772775-23772797 GGCGGGGGGCGGGGCCGAGGCGG + Intronic
1182123103 22:27799483-27799505 TGCGGGGGCTGCTGCTGAGGGGG + Exonic
1182576521 22:31276707-31276729 CGCGGGGGGCGCGGCGTTGGCGG + Intronic
1183386668 22:37519161-37519183 GGCGGGGGAGGCCGAGGAGGAGG - Exonic
1183535639 22:38398971-38398993 GGCGGGGGGCGGAGCGGGGGCGG - Intergenic
1183545377 22:38452549-38452571 TGCAGGGGGAGCGGCGGCGGTGG + Intronic
1183645617 22:39124338-39124360 TGCGGAGGGGGTCGGGGAGGGGG + Intronic
1184034311 22:41911225-41911247 TGTGGGGGGAGCCCCGGGGGAGG + Exonic
1184086917 22:42270733-42270755 GGCGGGGCGCGCGGCGGGGGCGG + Intronic
1184101509 22:42343753-42343775 CGCGGGCGGCGCCGCTGCGGTGG + Intergenic
1184131630 22:42519883-42519905 GGCGGGCGGGGCCGGGGAGGCGG - Intergenic
1184141848 22:42582098-42582120 GGCGGGCGGGGCCGGGGAGGCGG - Intergenic
1184342105 22:43891748-43891770 TGCGGCGGGCGCCCTGGAGGAGG + Exonic
1184523165 22:45007617-45007639 TGCTGGGGGCACCGCTGTGGCGG - Intronic
1184557377 22:45240721-45240743 TGCGGGCGGCGCCGAGGCCGAGG - Intronic
1184593861 22:45502823-45502845 GGAGGAGGGCGCGGCGGAGGCGG - Intronic
1185055402 22:48576254-48576276 GGAGGGGGGCGCCGCGGAGGGGG - Intronic
1185413426 22:50697566-50697588 TGCGGGGGGCGCAGGGGGCGCGG - Intergenic
949710189 3:6862717-6862739 TGAGGGGGGCGGGGGGGAGGAGG - Intronic
949970001 3:9396755-9396777 TGCGCGGGGCGCGGGGGTGGCGG - Intergenic
950334607 3:12183348-12183370 TGAGGGGGTGGCCGCTGAGGTGG - Exonic
950805772 3:15601905-15601927 GGCGTGGTGCGGCGCGGAGGGGG + Intronic
952430450 3:33218656-33218678 TGCGGGAGGCGGCGGGGCGGGGG - Intronic
952908929 3:38165765-38165787 TGGTGGGGGCGCGGCGGCGGCGG + Exonic
953705140 3:45225503-45225525 CGCGGTGGGCGCCCCGGCGGTGG + Exonic
953925339 3:46979796-46979818 ACCGGCGGGCGGCGCGGAGGAGG + Exonic
953925341 3:46979799-46979821 GGCGGGCGGCGCGGAGGAGGCGG + Exonic
954223976 3:49171223-49171245 TCCTGGGAGCTCCGCGGAGGTGG + Intergenic
954389252 3:50260302-50260324 CGGGGTCGGCGCCGCGGAGGCGG + Intergenic
954401460 3:50321751-50321773 GGCTGGCGGCGCCGCGGAGCTGG - Exonic
956647755 3:71473613-71473635 TGCGGGTGGTGGCGGGGAGGTGG - Intronic
956675046 3:71725335-71725357 GGCGGGGGGCGCGGCGGCCGGGG + Exonic
961673418 3:128550602-128550624 AGCGGGGCAAGCCGCGGAGGGGG + Intergenic
962301883 3:134250631-134250653 TGCGTGGGGCGGCGCGGCTGGGG - Exonic
963236869 3:142964105-142964127 TCCGGAGGTCGCCGGGGAGGGGG + Intergenic
963939707 3:151086338-151086360 TGCGGGGCGCGTGGCGGCGGGGG + Intronic
966712033 3:182980728-182980750 GGCGGGGGGCGCGGCGGGGGAGG + Intronic
966808754 3:183825620-183825642 CGCGGGGCGGGCCGCGGGGGCGG - Intergenic
966945234 3:184773160-184773182 TGCTGGGGGTGCGGTGGAGGGGG - Intergenic
967118394 3:186361916-186361938 GGCGGCCGGCGCGGCGGAGGGGG - Intronic
967272539 3:187743333-187743355 GGCGGGGGCCGGCGGGGAGGGGG + Intronic
967859052 3:194137978-194138000 TGCAGGGGGCGCCGCCGGGAGGG - Exonic
967904033 3:194486596-194486618 CGCGAGGGAGGCCGCGGAGGAGG - Intronic
968093013 3:195909692-195909714 TGCGGGGGCCGGCGCGGGGCGGG - Intronic
968114979 3:196082246-196082268 TGCGGAGGGCGCTGCGGGCGAGG + Intergenic
968652903 4:1767145-1767167 CGCGCGGGGAGCCCCGGAGGCGG - Intergenic
969330600 4:6471902-6471924 CCCGGAGGGCGGCGCGGAGGAGG + Intronic
969330867 4:6472761-6472783 TGCTGGGTGCGCCACGGGGGAGG + Intronic
969476089 4:7423105-7423127 TGCGGGGAGTGGCTCGGAGGAGG - Intronic
969638357 4:8382293-8382315 TGTGGGGGGCCCCGCAGATGTGG - Intronic
970333021 4:15003745-15003767 GGCGGGGGGCCCCCAGGAGGCGG + Exonic
971257939 4:25030915-25030937 TGCGGCGGGCGCAGCGGCGGCGG - Intergenic
971288443 4:25312678-25312700 GGCGGGGGCTGCCGCGGCGGAGG - Intergenic
971451366 4:26804664-26804686 GGCGGGAGCAGCCGCGGAGGCGG + Intergenic
972396612 4:38663969-38663991 TGGGCGGGGCGGGGCGGAGGCGG + Intergenic
973552785 4:52051989-52052011 TTCGGGAGGCGGCGCGCAGGCGG + Intronic
973993702 4:56436048-56436070 AGCGCGGGGCGGCCCGGAGGCGG + Intronic
977694302 4:99949811-99949833 GGCGGGACGCGCCGCGGTGGGGG - Intronic
978384899 4:108168879-108168901 TGCGGGGCAGGGCGCGGAGGAGG - Intronic
980923929 4:139115422-139115444 AGCCGGGGGCGTCCCGGAGGCGG - Intronic
985421518 4:189789314-189789336 TGTGGAGGGCACAGCGGAGGAGG + Intergenic
985548960 5:523818-523840 TGCGGGGCTCGGAGCGGAGGCGG + Intronic
985813859 5:2111815-2111837 CGGGGAGGGCGGCGCGGAGGCGG - Intergenic
986330518 5:6713649-6713671 CGCGGGGGCCGCGGCGGCGGCGG - Intergenic
986451441 5:7869342-7869364 TCCGGGGGTCGCCGCGGGCGCGG + Intronic
987374024 5:17217864-17217886 GGCGGGGCGCGGCGCGGTGGGGG - Intronic
988683040 5:33502266-33502288 TGCAGGGGGTGCCGAGGATGGGG + Intergenic
990955053 5:61332413-61332435 GGCGGGTGGCGCGGCGGCGGCGG + Exonic
992269936 5:75053556-75053578 TGCGGAGGCCGCCCCGGCGGGGG + Intergenic
992939652 5:81750491-81750513 CGCGGGGAGCGCGGCGGCGGGGG - Intronic
995379149 5:111512598-111512620 TCCCGGGGGCTCCGGGGAGGGGG + Intergenic
995524491 5:113039701-113039723 TGGGGGGGGGGGCGCGGAGTGGG - Intronic
996185282 5:120465634-120465656 TGCCGGCGGCGTCGCGGAGCTGG + Intronic
996329297 5:122311871-122311893 AGCCGGGGGCGCCGCGGGGAGGG + Intronic
998156108 5:139788169-139788191 TTCGGGGGGGGGCGCGGGGGGGG - Intergenic
999140401 5:149357840-149357862 TGCGGGGGGCGGGGCGGAACGGG + Intergenic
1001296726 5:170503992-170504014 GGCGGAGGGGGCGGCGGAGGGGG - Intronic
1001314714 5:170633743-170633765 GGCGGGGGGCGGGGCGGAGGGGG + Intronic
1001529924 5:172454548-172454570 TGCGGGGGGCGGGCCGGGGGCGG - Intergenic
1002621964 5:180494426-180494448 CGAGGGGGGCGCGGAGGAGGAGG + Exonic
1003995645 6:11537653-11537675 TCCGGGGAGCGCAGGGGAGGAGG + Intergenic
1004561869 6:16760229-16760251 GGCGGCGGCCGCCGCGGAGGAGG - Intronic
1006320713 6:33317753-33317775 GGCGGGAGGCGGAGCGGAGGCGG - Intronic
1006404382 6:33835726-33835748 TGCGGGGGGGGGGGCGGGGGGGG + Intergenic
1006425544 6:33960752-33960774 TGCTGGGGCTGCCGCGTAGGAGG - Intergenic
1006676263 6:35765856-35765878 TGCGGCGTGTGCCGGGGAGGCGG - Intergenic
1006860819 6:37170605-37170627 TGCAGGGCGCGGCGCGCAGGTGG - Exonic
1007600125 6:43076237-43076259 TGCGGGGGCCGGAGGGGAGGGGG + Intergenic
1007633112 6:43283638-43283660 TGATGGGGGCGCTGTGGAGGAGG + Exonic
1007902043 6:45422023-45422045 AGCGGCGGCCGCCGCGGAGGCGG + Intronic
1008598454 6:53065727-53065749 TCCGGGGGGCGGTGCAGAGGGGG + Intronic
1014272315 6:119348989-119349011 GGCGGGGGGCTCGGCGGCGGCGG - Exonic
1015149040 6:130019143-130019165 CTCGGGGGGCGCGGGGGAGGGGG - Intronic
1015843865 6:137497831-137497853 GGCGGGCTGCGCCGCGGAGGCGG + Intergenic
1017670887 6:156768547-156768569 GGCGGGGGGCGGCGTGCAGGGGG + Intergenic
1018091258 6:160348318-160348340 GGCGGGTGGCGCGGGGGAGGCGG + Exonic
1018876566 6:167827002-167827024 GGCGGAGGCAGCCGCGGAGGCGG + Exonic
1019202849 6:170333157-170333179 TGCGGGGGGCGGGGGGGCGGTGG - Intronic
1019298220 7:290102-290124 GCCGGCGGGCGGCGCGGAGGAGG + Intergenic
1019298222 7:290105-290127 GGCGGGCGGCGCGGAGGAGGCGG + Intergenic
1019305610 7:332990-333012 CGCGGGGCCCGCCGGGGAGGCGG + Intergenic
1019381681 7:727370-727392 TGTGAGAGGGGCCGCGGAGGTGG - Intronic
1019536298 7:1531255-1531277 TGCGGGGGGCGGGGCGGGGCGGG + Intronic
1019731508 7:2631928-2631950 TGCGGAGGGGGCGGCGGCGGCGG + Intergenic
1022449798 7:30504399-30504421 GGCAGTGGGCGCAGCGGAGGAGG + Intronic
1022506702 7:30912113-30912135 TGAGGTGGGCGCCGCTGATGTGG - Exonic
1022528268 7:31052191-31052213 TGCGGTGGGGGGCGCGGTGGGGG - Intergenic
1023875829 7:44285813-44285835 GGGGGGAGGCGCGGCGGAGGGGG + Intronic
1025739055 7:64182055-64182077 TGCGGGGGCGGAGGCGGAGGCGG - Intronic
1026806808 7:73434024-73434046 TGCGGGGGGCGCTGCTGCTGTGG + Exonic
1027218891 7:76201817-76201839 TGCGGAGGGCGCTGCGGGCGCGG + Intergenic
1027264792 7:76488369-76488391 TGGTGGGGGCGGGGCGGAGGGGG + Intronic
1027316163 7:76986471-76986493 TGGTGGGGGCGGGGCGGAGGGGG + Intergenic
1028796389 7:94908065-94908087 GGCGGGGGGCGCCTGCGAGGAGG + Intronic
1029123191 7:98281722-98281744 GGCGGGGGACGCGGCGGCGGCGG - Exonic
1029188296 7:98754939-98754961 TGCGGGGGGGGGGGCGGGGGGGG - Intergenic
1030659621 7:112205892-112205914 TGCGGGGCGCGCCGAGCAGGCGG + Intronic
1031134834 7:117873337-117873359 GGCGGGGGCCGCGGCGGAGGCGG - Exonic
1031134835 7:117873340-117873362 CGCGGCGGGGGCCGCGGCGGAGG - Exonic
1031997234 7:128240897-128240919 TGTGAGGGGCTCCGCGGAGCGGG - Intergenic
1033453615 7:141482913-141482935 TGCGGGGGGCGGTGGGGGGGTGG + Intergenic
1034188217 7:149195452-149195474 GGCGGGGAGCGCCGCCGAAGGGG + Intergenic
1034192722 7:149224074-149224096 TGGGGGCGGCGGCGCGGAGGCGG + Exonic
1034192742 7:149224155-149224177 TGCTGCGGGCGCCGTGCAGGAGG - Exonic
1034676658 7:152897047-152897069 GGCTGGGGGCTCCGAGGAGGTGG + Intergenic
1034976110 7:155450036-155450058 GGCGTTGGGCGCTGCGGAGGAGG + Intergenic
1035160914 7:156949583-156949605 TGCGGGGGCAGCCGGGCAGGTGG - Intergenic
1035167464 7:157000091-157000113 CGCGGGGGGCGGAGCGGGGGAGG + Intronic
1035282538 7:157787025-157787047 TGCGGCGGGGGACGCGGGGGTGG + Intronic
1035282556 7:157787070-157787092 TGCGGCGGGGGACGCGGGGGTGG + Intronic
1035282574 7:157787115-157787137 TGCGGCGGGGGACGCGGGGGTGG + Intronic
1035282592 7:157787160-157787182 TGCGGCGGGGGACGCGGGGGTGG + Intronic
1035476116 7:159145084-159145106 GGCGCGGGGCGCAGCGGAAGGGG - Intergenic
1035725827 8:1824292-1824314 GGCCGGGGGCGCCGCGGAAGGGG - Intronic
1036731783 8:11271829-11271851 TGCGGGCGGCGGCGGGGGGGTGG + Intergenic
1037273834 8:17156864-17156886 CGCTGGGGGCGCCGCGGCGGGGG - Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1037886704 8:22599537-22599559 GGCGGGGGGCGGGGCGGTGGGGG - Intronic
1038204961 8:25457909-25457931 TGCGGGGGGCGCGGGGACGGGGG - Intronic
1038311437 8:26449144-26449166 TGCGGGGGCCGCTGCGGGTGCGG - Intronic
1039608529 8:38901520-38901542 TGCAGGGGGCGCCCCGGCGGAGG + Intronic
1041016154 8:53594693-53594715 TGCGGGGGGCGCCGTGTGGCTGG + Intergenic
1041689913 8:60678755-60678777 TGCTGGGGCCGCGGCGGCGGCGG + Intergenic
1042858990 8:73294851-73294873 GGAGGGGTGCGCAGCGGAGGCGG - Exonic
1043296129 8:78665984-78666006 TGGGGGCGGGGCCGCGGCGGAGG - Intergenic
1046547307 8:115668482-115668504 TGCGGGGGGCGCGGGGGGCGCGG - Intronic
1048981172 8:139703920-139703942 GGCGGCGGGCGCGGCGGCGGCGG + Intergenic
1049532295 8:143160497-143160519 AGCAGGGGGCGCCGCGAGGGAGG - Intronic
1049548566 8:143246220-143246242 AGCCGTGGGCGCCGCGGAGGCGG + Intergenic
1049707958 8:144051480-144051502 CGCGGGGGGGGGCGGGGAGGCGG + Intronic
1050592207 9:7172629-7172651 TGTGGGGGAAGCCGTGGAGGTGG + Intergenic
1050653651 9:7799981-7800003 CGGGGGGGGCGGCGGGGAGGAGG - Exonic
1051038284 9:12775842-12775864 TGCGGGGGGAGCGGTGGTGGTGG + Exonic
1053697401 9:40650740-40650762 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054308706 9:63450186-63450208 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054407370 9:64773879-64773901 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054489437 9:65762641-65762663 GGCGGGGGCCGCGGCGGTGGGGG - Intergenic
1054809354 9:69422420-69422442 TGGGGAGGGCGCAGAGGAGGTGG + Intergenic
1056643328 9:88388787-88388809 GGCGGGGGGCGGCGGGGATGGGG - Intronic
1058885714 9:109320291-109320313 GGCGGGCAGCGCCGAGGAGGAGG + Exonic
1059191854 9:112333917-112333939 GGCGGGGTGCGCGGCGGAGCGGG - Intergenic
1061128213 9:128689744-128689766 CGCGGGGGGCGCCGGGCGGGGGG + Intronic
1061242022 9:129380107-129380129 GGCGGGGGGCGGCGGGGAGAAGG + Intergenic
1061317157 9:129803444-129803466 TGCGGGGGGCGCGGGGGCGCGGG + Intronic
1061786237 9:133030338-133030360 TGCGGGGGGCCTCGCGGAGGTGG - Intergenic
1061989719 9:134152407-134152429 TGCTGGGGGTGCTGCCGAGGTGG + Intronic
1062389204 9:136327408-136327430 TGCGGGGGGCGGGGCGGACGCGG - Intergenic
1062659093 9:137619065-137619087 GGCGGGGGGCGGCGCGGGGGCGG + Intronic
1186426071 X:9465136-9465158 TGAGGCGGGCGCGGCGGCGGCGG - Exonic
1188005379 X:25013031-25013053 TGCGGGCAGCGACTCGGAGGAGG - Exonic
1189329380 X:40134041-40134063 TGGGAGGGGCTCCGCAGAGGAGG + Intronic
1190324889 X:49200225-49200247 GGCGCGGGGCGCGGCGGGGGCGG + Exonic
1192925006 X:75747097-75747119 TGCGGCGGCGGCCGCGGCGGCGG - Intergenic
1198387520 X:136143850-136143872 TACGGGGGGGGGCGGGGAGGGGG + Intergenic