ID: 1064357296

View in Genome Browser
Species Human (GRCh38)
Location 10:14631423-14631445
Sequence GTGCTGTAGAATTTATACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064357296_1064357299 29 Left 1064357296 10:14631423-14631445 CCAGTGTATAAATTCTACAGCAC 0: 1
1: 0
2: 0
3: 16
4: 120
Right 1064357299 10:14631475-14631497 CAGATTTCTTTTCTGGAATTTGG No data
1064357296_1064357298 22 Left 1064357296 10:14631423-14631445 CCAGTGTATAAATTCTACAGCAC 0: 1
1: 0
2: 0
3: 16
4: 120
Right 1064357298 10:14631468-14631490 TTAGAGACAGATTTCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064357296 Original CRISPR GTGCTGTAGAATTTATACAC TGG (reversed) Intronic
905232573 1:36523523-36523545 GTTCTGGAGCATTTATAGACAGG + Intergenic
906368007 1:45227213-45227235 GGGCTGTACAATTTGTAAACTGG + Intronic
907576439 1:55530263-55530285 ATGCTGTAGAATTTTTCTACTGG + Intergenic
909493819 1:76255412-76255434 ATGCTGTAGCACTTATCCACTGG + Intronic
909493917 1:76256779-76256801 GTGCTGTGTAAGTTATAAACAGG + Intronic
910751298 1:90634064-90634086 GGGCTGGAGCATTTATCCACTGG + Intergenic
911559594 1:99388509-99388531 GAGCTCTAGGATTTATAGACTGG - Intergenic
913335713 1:117707717-117707739 GTGATGAAGTAATTATACACTGG + Intergenic
917045070 1:170850588-170850610 GTGCTGTTGAATTTGAACTCAGG - Intergenic
917843490 1:179001824-179001846 CTGCTGTAGACTTTAAAAACAGG + Intergenic
920520448 1:206620790-206620812 GTGCTGCAGACTTTGGACACTGG - Intergenic
1064042718 10:11982333-11982355 CTGCTGTAGAGTTTATACCTGGG - Intronic
1064357296 10:14631423-14631445 GTGCTGTAGAATTTATACACTGG - Intronic
1067349843 10:45465659-45465681 GTGCTGTTGAATCTCTGCACTGG - Intronic
1067719569 10:48717492-48717514 GAGCTATAGAATGTGTACACAGG - Intronic
1068825322 10:61431591-61431613 GAGCTGTAGAATTTATAGATTGG + Intronic
1081820722 11:45991636-45991658 GTGCTGTAAAAATAATACACTGG + Intronic
1084839538 11:71833811-71833833 GTAATGTAGAATTTAAACACAGG + Intronic
1085835435 11:79950876-79950898 GAGCTGCAGAAGTTACACACTGG + Intergenic
1088438037 11:109837234-109837256 CTGCTGTAGATTTTTAACACTGG + Intergenic
1091246259 11:134097764-134097786 GATCTGTAGAATTTATAAAGTGG - Intronic
1091597210 12:1886165-1886187 TTGCTCTAGAAATCATACACAGG - Intronic
1093498480 12:19783654-19783676 CTGCTGTAGCATTCATGCACTGG - Intergenic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1095876368 12:47083297-47083319 GTCAGGTGGAATTTATACACTGG + Intronic
1099122386 12:78707581-78707603 TTGCTATTGAATTTACACACAGG - Intergenic
1100736658 12:97542418-97542440 GTGCTGATGAATTTAGAAACAGG + Intergenic
1103104587 12:118212346-118212368 TTACTGTAGACTTTATACATAGG - Intronic
1104091435 12:125521058-125521080 GAGCTGGAGAATTTATAGATGGG - Intronic
1105330445 13:19410947-19410969 TGGCTGTAGAATTGATACGCAGG + Intergenic
1107482003 13:40792943-40792965 TGGCTGTAGCATTGATACACAGG + Intronic
1109077042 13:57849004-57849026 GTGCTGCAGAAATTTTACCCAGG + Intergenic
1110908627 13:80925560-80925582 GAACTGGAGAATTTATATACTGG + Intergenic
1111393830 13:87636300-87636322 GTGCTTCAGAGTTTATATACAGG - Intergenic
1117484047 14:56175970-56175992 GAGCTGTAAAATGTAAACACAGG - Intronic
1128915712 15:71560368-71560390 GTGCTGTGGAATTCATAAAGAGG + Intronic
1130721630 15:86392142-86392164 TGGCTGTAAAATTTATACAAAGG - Intronic
1131655078 15:94447856-94447878 GGGATATACAATTTATACACAGG + Intronic
1133494923 16:6308896-6308918 GTGCTGTAGAGTTTAAAAAGTGG - Intronic
1137796873 16:51228485-51228507 GTGATGTAGAATTTATTCTCAGG - Intergenic
1137940726 16:52681300-52681322 GGGCTGTAGAAAATATAAACTGG + Intergenic
1139266570 16:65645401-65645423 GAGCTTTGGAAATTATACACTGG - Intergenic
1140426770 16:74867682-74867704 GTGCAGCAGATTTTATAGACAGG - Intergenic
1141326635 16:83066158-83066180 GTGCTTTACAAATTATAGACAGG - Intronic
1142800320 17:2340883-2340905 TTTCTGTAGAAATTAAACACTGG - Intronic
1144245516 17:13359913-13359935 ATGGAGTAGAATTTACACACAGG - Intergenic
1146816556 17:35947263-35947285 GTGCTGTGCAATTTATCCAGTGG + Intergenic
1148359684 17:47001319-47001341 GTGCTGTGCAATTTATCCAGTGG - Intronic
1150787168 17:68172567-68172589 GTGCTGTGCAATTTATCCAGTGG + Intergenic
1154935312 18:21048875-21048897 CTTCTGTAGAATTTATATATAGG - Intronic
1155554740 18:27006297-27006319 GCTCTCTAAAATTTATACACTGG + Intronic
1156420346 18:36945833-36945855 GTGCTTAAGAATTTATACTGGGG - Intronic
1158935186 18:62358079-62358101 GAGCTGAAGAAGTTAGACACAGG + Intronic
1159463358 18:68748381-68748403 ATGCTGTAGATTTTATATTCAGG - Intronic
1162842169 19:13364562-13364584 GAGCTGGGGTATTTATACACTGG - Intronic
1168510437 19:56969257-56969279 GAGCTCTAGAATTTCTACATGGG + Intergenic
925346615 2:3176363-3176385 GTGCTCATGTATTTATACACAGG - Intergenic
927454391 2:23237222-23237244 GTGCCGTAAAATATACACACTGG - Intergenic
929998462 2:46845049-46845071 GAGCTGAAGAATTCATCCACTGG - Intronic
930493514 2:52108038-52108060 CTGCTGAAAAATTTATACCCTGG - Intergenic
936887422 2:117329574-117329596 GTGCTGTAGAATAAAGACAGTGG + Intergenic
947397968 2:229705287-229705309 GTCCTTTAGAATTTCAACACTGG - Intronic
1170894549 20:20401917-20401939 GGCCTGTACAATTTATACAGTGG - Intronic
1171442440 20:25176257-25176279 GAGCTGGGGTATTTATACACGGG - Intergenic
1171442797 20:25178981-25179003 GTGCTGGAGTGTTTATACACTGG - Intergenic
1174543884 20:51310539-51310561 TTGCTGGAGATTTTATACGCTGG - Intergenic
1178853557 21:36232724-36232746 GTGCTGTAGAATCTGCAGACTGG + Intronic
1179841401 21:44077194-44077216 ATGCTTCATAATTTATACACAGG + Intronic
1180564444 22:16650891-16650913 TGGCTGTAGAATTGATACGCAGG - Intergenic
950048358 3:9965842-9965864 GTACAGTAGAATATATACAATGG - Intronic
954772819 3:52988275-52988297 ATGCTGTACAATTAATTCACTGG + Intronic
955002879 3:54943407-54943429 GTGCTTTGGACTTTTTACACCGG + Intronic
965967043 3:174505174-174505196 GTGGTGAAGAATTTTTACAATGG - Intronic
966266837 3:178056364-178056386 GTCCTGTAAAAGTTGTACACTGG + Intergenic
966363645 3:179157527-179157549 GTGCTTTAGCAGTTATACACTGG - Intronic
967476574 3:189928175-189928197 TTGCTGTAGAATTGATTCATTGG + Intergenic
969780625 4:9399815-9399837 GTAATGTAGAATTTAAACACAGG + Intergenic
970159781 4:13176908-13176930 GTGATGTGGATTTTATATACAGG - Intergenic
974357361 4:60830463-60830485 ATACAGTAGCATTTATACACTGG - Intergenic
976565795 4:86549613-86549635 CTACTGTAGACTTTATAAACAGG + Intronic
977691970 4:99922310-99922332 GTACTGTAAACATTATACACTGG + Intronic
981244416 4:142517134-142517156 CTGCTGTAGAATTTATTTCCTGG - Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
983156807 4:164358006-164358028 AGGCTGTAGAAATTACACACTGG + Intronic
984384159 4:179033847-179033869 GTGCTGTTGAATTTTTTCAAAGG - Intergenic
985054795 4:186026843-186026865 GTGCAGTAGAAATTATGGACTGG - Intergenic
986495394 5:8336744-8336766 GTGCTGTTCAAATTATACAATGG + Intergenic
988464117 5:31471768-31471790 GGGCTGTAAAATTTGTACTCTGG - Intronic
992695093 5:79278244-79278266 GTGCTTTAGAATGGATACTCAGG - Intronic
993066492 5:83105172-83105194 TTGCTGTCAAATTTATACACAGG + Intronic
993359795 5:86960365-86960387 GTGTTGTAGGTTATATACACAGG + Intergenic
999062384 5:148650252-148650274 GTGCTCTATCATTTATTCACTGG + Intronic
999613267 5:153394338-153394360 GTGGTGTACTATTAATACACAGG + Intergenic
1003693908 6:8382904-8382926 CTTCTGAAGAATGTATACACTGG + Intergenic
1005689056 6:28284165-28284187 GTGCTGGAGAATCTAGAGACAGG + Exonic
1006061509 6:31423641-31423663 GTGCACTGGATTTTATACACAGG + Intergenic
1006249227 6:32766399-32766421 GTGCAGTTGAATGTAAACACAGG + Intergenic
1010115217 6:72298161-72298183 ATGCTGTAAAATTAATAGACTGG - Intronic
1010343799 6:74788172-74788194 GTGCTGTTGAATTTTGTCACAGG + Intergenic
1010899985 6:81415153-81415175 GTGCTGCAGAAATTTTACCCAGG + Intergenic
1013864895 6:114684096-114684118 GTGCTGTAGATTTAAGACATGGG + Intergenic
1014622014 6:123679036-123679058 GTGCTGTAGGATAAATACATAGG + Intergenic
1014785903 6:125618940-125618962 GTTCTGAAGAATTTATAAGCTGG + Intergenic
1017787141 6:157765792-157765814 CTGCTGTAATATTTATTCACAGG + Intronic
1018183360 6:161243607-161243629 GTGCTGTAACAATTACACACAGG + Intronic
1020482856 7:8683465-8683487 GTGATTTAGAATTCTTACACAGG + Intronic
1020538034 7:9425594-9425616 GTTCTGGAGACTTAATACACAGG - Intergenic
1022339242 7:29453122-29453144 ATGCTGTGGAATTTATCCATTGG - Intronic
1023337590 7:39186539-39186561 GTGCTGAGGAATCTATACAAAGG - Intronic
1026071788 7:67128432-67128454 GTGCTGTGTACTTTATCCACTGG + Intronic
1026705113 7:72683830-72683852 GTGCTGTGTACTTTATCCACTGG - Intronic
1027459990 7:78440334-78440356 GTGCTGTAGAATTTGAACTCGGG + Intronic
1029898961 7:104019932-104019954 GTGCTATAGAATGGGTACACAGG + Intergenic
1030068369 7:105677844-105677866 GTGCTGTTGAAAGTAGACACTGG - Intronic
1034453028 7:151147982-151148004 GTGCTGAAGAATTTCTACAGAGG + Intergenic
1035979019 8:4347950-4347972 GCACAGAAGAATTTATACACGGG + Intronic
1036278060 8:7373748-7373770 GTAATGTAGAATTTAAACACAGG + Intronic
1036343463 8:7938144-7938166 GTAATGTAGAATTTAAACACAGG - Intronic
1036838804 8:12098908-12098930 GTCTTGTAGAATTTAAACACAGG - Intergenic
1036860592 8:12345151-12345173 GTCTTGTAGAATTTAAACACAGG - Intergenic
1037221551 8:16528730-16528752 GTGCACTAGATTTTATAGACAGG + Intronic
1041038869 8:53825541-53825563 GTGCTGGAGCATGAATACACAGG + Intronic
1042447353 8:68901622-68901644 GTGCAAAATAATTTATACACTGG + Intergenic
1044479154 8:92664970-92664992 GTGATGAAGAATTAATACACTGG + Intergenic
1047996171 8:130338636-130338658 GTGCTGGAAAATGTACACACTGG + Intronic
1051278105 9:15416499-15416521 GTGGTGTAGAATTTAGAATCAGG - Intergenic
1053363205 9:37504198-37504220 GTGCTGTAGAATTGTGACAAGGG + Intergenic
1055799303 9:80015484-80015506 GTGCTGTAGGATATATCAACAGG + Intergenic
1186650418 X:11554074-11554096 GTGCTGTATAATATACACAATGG + Intronic
1188031754 X:25271735-25271757 GTGATTTAGAATTTAGACCCTGG + Intergenic
1192727209 X:73765901-73765923 GTGCTGGAGAATGTCTACAAGGG + Intergenic
1193925645 X:87480156-87480178 GTGCTTAAGAATTTACACAAAGG + Intergenic
1194044993 X:88991683-88991705 TTGCTGAAGATTTTATACAATGG - Intergenic
1197872239 X:131071289-131071311 GTGCTCTAGAATGTATAAAGGGG + Intronic
1198445221 X:136706732-136706754 GTGCTCAAGAATTTATTCATTGG + Intronic
1198968537 X:142253303-142253325 GTGATGTCATATTTATACACAGG + Intergenic
1202600874 Y:26591862-26591884 TGGCTGTAGAATTGATACACAGG - Intergenic