ID: 1064358316

View in Genome Browser
Species Human (GRCh38)
Location 10:14639843-14639865
Sequence CAGTGTTAGCTGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064358316_1064358319 -9 Left 1064358316 10:14639843-14639865 CCTTCCTCCTTCAGCTAACACTG 0: 1
1: 0
2: 0
3: 25
4: 343
Right 1064358319 10:14639857-14639879 CTAACACTGCTGCTACTACCCGG No data
1064358316_1064358323 20 Left 1064358316 10:14639843-14639865 CCTTCCTCCTTCAGCTAACACTG 0: 1
1: 0
2: 0
3: 25
4: 343
Right 1064358323 10:14639886-14639908 CTTCTTTCTTTGTCTAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064358316 Original CRISPR CAGTGTTAGCTGAAGGAGGA AGG (reversed) Intronic
901749557 1:11397470-11397492 CAGGGTTGGCTGCAAGAGGAAGG - Intergenic
901773933 1:11546143-11546165 CAGTGACAGCTCAGGGAGGAGGG - Intergenic
902563752 1:17296057-17296079 CAGAGTTAGCCCAAGGAGCAAGG - Intergenic
906060716 1:42946725-42946747 CAGTGCTAGGTGTAGGGGGAGGG + Intronic
906863482 1:49389162-49389184 CATTCTTAGCTGAAGGAAGGAGG - Intronic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
910464922 1:87488470-87488492 AAGTGTTGGCTGAAGGCGGATGG + Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
910930295 1:92436730-92436752 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
912222636 1:107695795-107695817 CAGTGTTAAATGAAAGAGAAAGG + Intronic
912667993 1:111600241-111600263 CAATGTGAGCTGAAAGAAGAGGG - Intronic
912867230 1:113268458-113268480 CAGAGTTAGCTAAGTGAGGATGG - Intergenic
913003988 1:114610204-114610226 CATCGTTAGATGAAGGATGAAGG + Intronic
913425196 1:118720879-118720901 CAGTGTTAGTTGTAGAAGGATGG - Intergenic
914359758 1:146923538-146923560 AGGTGTTGGCTGAAGGGGGATGG + Intergenic
914493993 1:148176356-148176378 AGGTGTTGGCTGAAGGGGGATGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916251816 1:162746145-162746167 GAGTGTGAGCTGAAGCAGGGTGG + Intronic
917646904 1:177038164-177038186 AGGAGTTAGCTGAAGGAGGGAGG - Intronic
917893786 1:179466086-179466108 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
919252555 1:195075950-195075972 CAGTTTTAGCTCAAGGAATATGG + Intergenic
919355205 1:196513630-196513652 AAGTGAGAGCTGAAGGAAGAAGG - Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920227177 1:204447275-204447297 TAGTGTCAGCTGATGGAGAAAGG + Intronic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920432831 1:205929581-205929603 GAGTTTGGGCTGAAGGAGGAGGG + Intronic
921683919 1:218067991-218068013 CAGTGGTTGGTAAAGGAGGAGGG + Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922533421 1:226362045-226362067 TAATGTTAGCTGAAGGATCAGGG + Exonic
923941404 1:238831518-238831540 CAGTCATGGCTGAAGGTGGAGGG - Intergenic
923999520 1:239535151-239535173 CAGTGTTTGCTGAAGGAAGGGGG + Intronic
924167626 1:241301547-241301569 AAGTGTTTGCTGAAGGACAATGG + Intronic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1063654082 10:7969784-7969806 CAGTGCTGGCTGAGGGAGCATGG + Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064829538 10:19446251-19446273 GAGTGTAAGCTGAAGCAGGGTGG - Intronic
1065022857 10:21515383-21515405 CAGTTTTACCTGTAGGACGAGGG + Exonic
1065358538 10:24867250-24867272 CAGAGTTAAATGAAGGAGGGAGG - Intronic
1066162959 10:32754794-32754816 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1067535204 10:47104416-47104438 CAGTGCTAGATGAAGGGAGAGGG + Intergenic
1069227229 10:65959357-65959379 GAGTGTTAGCTGAAGCAGGGAGG - Intronic
1069355944 10:67585031-67585053 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1069417151 10:68210613-68210635 CAGTCTCAGCTGAGGGAGAAAGG + Exonic
1069598249 10:69686648-69686670 AAATGTTAGCTGGAGGGGGATGG + Intronic
1070327724 10:75399380-75399402 CAGTGGTAGCTGAGGCAGTAAGG + Exonic
1070546447 10:77456588-77456610 AAATGTTTGCTGAAGGAGGGAGG + Intronic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1071663208 10:87527088-87527110 CATTGGTAGCTTAATGAGGATGG + Intronic
1071745448 10:88413674-88413696 AAGAGTTATCTGAAAGAGGAAGG - Intronic
1072695546 10:97600351-97600373 CCTTGTTGGCTGAAGGAGGATGG + Intronic
1073302855 10:102481456-102481478 TAGTGATAGGTGAAGGAGGTTGG - Intronic
1073771300 10:106738543-106738565 CAGTGTGAGAGGAAGGAGGCTGG + Intronic
1074010396 10:109472942-109472964 CAGTGTTTTCTGAAGGTCGAGGG + Intergenic
1074438278 10:113453008-113453030 GAGAGTCAGCTGAGGGAGGAAGG - Intergenic
1074552956 10:114462251-114462273 TAATAATAGCTGAAGGAGGAAGG - Intronic
1074563788 10:114558179-114558201 CAGTACTAGCTAAAGGAGAAGGG - Intronic
1076427659 10:130379200-130379222 CAGTGTGAGCTGAGGAGGGAAGG - Intergenic
1076540302 10:131210278-131210300 CAGTGTCAGCTCAAGGACCAAGG + Intronic
1076608073 10:131702188-131702210 CAGGGTTTGCTGAAAGATGAGGG - Intergenic
1077923361 11:6657001-6657023 CAGTTTCAGCTGAAGAAGAAGGG + Intergenic
1078298963 11:10105866-10105888 CAGTGATAGCTGACAGAGGGAGG + Intronic
1079339135 11:19597756-19597778 CATTTTTAGCTGAAGGAGGTGGG + Intronic
1080818231 11:35779410-35779432 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1080917350 11:36673564-36673586 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1081509039 11:43749508-43749530 CAGTGTGAGAGGAAGCAGGAGGG + Intronic
1082571327 11:54743925-54743947 CATTGTTAGCTTAATGGGGATGG + Intergenic
1082612402 11:55317110-55317132 CAGTTTTAGCTGAAGCAGTGTGG + Intergenic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1083598234 11:63930166-63930188 AAATGTTAGCTGAAGGAATATGG - Intergenic
1084517713 11:69645468-69645490 CAGCGGTGGGTGAAGGAGGAGGG + Intronic
1086109078 11:83179165-83179187 CAGTGTTGGGTGAAGGAGAAAGG - Intronic
1086607552 11:88714276-88714298 CAGTGGTAGGTGAAAGGGGAGGG + Intronic
1086812073 11:91322271-91322293 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1087613941 11:100467114-100467136 AAGATTTAGATGAAGGAGGAGGG - Intergenic
1088132309 11:106508161-106508183 CAGTGTTTGCTGAGGCAGCAGGG - Intergenic
1088162699 11:106892616-106892638 CATTCTTTGTTGAAGGAGGAAGG - Intronic
1088186945 11:107181094-107181116 CAGAGCTAGAGGAAGGAGGAGGG + Intergenic
1090961238 11:131558755-131558777 TAGTGTCAGCTGGAGGAGAAGGG + Intronic
1091337883 11:134786134-134786156 CAGTCTGAGATGCAGGAGGAAGG - Intergenic
1092301592 12:7255703-7255725 CATTGGTAGCTTGAGGAGGATGG - Intergenic
1092589281 12:9935772-9935794 CATCGTTAGCAAAAGGAGGATGG - Intergenic
1092653872 12:10664341-10664363 CAGTGGTCTCTGTAGGAGGATGG - Intronic
1092711313 12:11340388-11340410 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1093639337 12:21508056-21508078 TAGTTTTAGCTGGATGAGGAAGG - Intronic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1095241132 12:39860101-39860123 CTGTGTTAGCTAAAAAAGGAAGG + Intronic
1096137529 12:49214929-49214951 AAGTGTTAGCTGAGGAAGGAAGG - Intronic
1096510220 12:52123735-52123757 CAGCTTTGGCTGAGGGAGGATGG - Intergenic
1098246072 12:68519326-68519348 CAGTGAGGCCTGAAGGAGGAAGG - Intergenic
1099025879 12:77463856-77463878 CATTGGTAGCTTAATGAGGATGG - Intergenic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1100463396 12:94822961-94822983 GAGTGTTAGGTGAAGCAGGGCGG + Intergenic
1100965698 12:100010900-100010922 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1101391887 12:104308706-104308728 CAGTTGTAGTTGGAGGAGGATGG + Intronic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1102596577 12:113997350-113997372 CAGTGTGAGATGAAGCTGGAAGG + Intergenic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1105303750 13:19155478-19155500 CACTGCTAGGTGGAGGAGGAGGG + Intergenic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1107028683 13:35829181-35829203 CTGTGATAGGTGTAGGAGGAAGG + Intronic
1107822332 13:44297014-44297036 CAGTGTGAGCTTAAGAAGGAGGG - Intergenic
1109726591 13:66349186-66349208 CAGTGTTTCCTGGAGGAGGGAGG + Intronic
1110399743 13:75076100-75076122 CATTGTTAGCTGAAAGATAAAGG + Intergenic
1113267220 13:108633062-108633084 CATTGTTTGCAGCAGGAGGAAGG + Intronic
1113383871 13:109829344-109829366 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1114677563 14:24453874-24453896 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1115043921 14:28966320-28966342 AAGTTTTAACTGAAGAAGGATGG - Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118329657 14:64805489-64805511 TAGTGTTAAGTGAAGGAGGTGGG - Intronic
1118632495 14:67718514-67718536 CAGTGTTAGCCCTGGGAGGATGG + Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1120478962 14:85024318-85024340 CAGTGTGAGCCGAAGCAGGGCGG - Intergenic
1121375813 14:93410092-93410114 CACTGCTAGGTGAGGGAGGAAGG - Intronic
1121586923 14:95068924-95068946 AAGAGATGGCTGAAGGAGGAAGG + Intergenic
1122672411 14:103382871-103382893 CAGAGTTAGCTGTGGGAGGATGG - Intergenic
1122884611 14:104705477-104705499 CAGTGTGGGCTGAAGGGGGCCGG + Intronic
1124021980 15:25933618-25933640 AAGTGTTACCTGAAGGACGGTGG + Intergenic
1124094158 15:26633318-26633340 CAGGGTCAGCTGCAGTAGGATGG - Intronic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1125227605 15:37412740-37412762 CAGTGGTAGCTTAATGGGGATGG - Intergenic
1125931630 15:43604342-43604364 CAGGGTGAGATGAAGGAAGAAGG - Exonic
1125944734 15:43703822-43703844 CAGGGTGAGATGAAGGAAGAAGG - Intergenic
1126330158 15:47523089-47523111 CACTGTTAGCAGATGGAAGATGG - Intronic
1127410705 15:58703790-58703812 CAGTCATAGCAGAAGGAGAAGGG - Intronic
1128927918 15:71675656-71675678 GAGGGTTAGATGAAGGAGGTGGG - Intronic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1130045430 15:80440594-80440616 CACTGTTAGCTGAGGTGGGAGGG + Intronic
1131151488 15:90049977-90049999 CATTGTTAGGTGACTGAGGAAGG + Intronic
1135434825 16:22419922-22419944 CAGTGTGGGATGGAGGAGGAGGG - Intronic
1136014173 16:27384173-27384195 CAGAATTGGCTGAAAGAGGAAGG - Intergenic
1136471065 16:30480583-30480605 CAGTGTTACATGAGGGAGCAAGG + Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138077711 16:54058646-54058668 CAGTTATACCTGCAGGAGGATGG - Intronic
1139613140 16:68073109-68073131 CTGTGGTGGCTGAAGCAGGAAGG + Intronic
1141319033 16:82989399-82989421 CAGTGTGAGCTGGAGAGGGATGG + Intronic
1141813401 16:86391973-86391995 CAGTGTCTGCTGGAGGAGGCAGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142044011 16:87913699-87913721 CAGTGTGGGGTGGAGGAGGAGGG - Intronic
1142503621 17:348726-348748 CCCTGTTTGCTAAAGGAGGAAGG + Intronic
1142985197 17:3691090-3691112 CAGCGTTACCTGAAAGAGGGCGG + Intronic
1144033553 17:11343193-11343215 CAGTGTTAGCCTCTGGAGGAAGG + Intronic
1144878581 17:18418229-18418251 CAGTGTTAGCTGCTGGAATAAGG + Intergenic
1144885171 17:18453011-18453033 CAGTGTTAGCTGCTGGAATAAGG - Intergenic
1145065821 17:19760442-19760464 CAGTGTGAGCTGAAGGCGCATGG - Intergenic
1145147047 17:20491366-20491388 CAGTGTTAGCTGCTGGAATAAGG + Intergenic
1145153653 17:20526158-20526180 CAGTGTTAGCTGCTGGAATAAGG - Intergenic
1145177115 17:20710455-20710477 CAGTGTTAGCTGCTGGAATAAGG + Intergenic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147788525 17:42998026-42998048 CACTGTTAGCTAAAGAGGGAGGG - Intergenic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148483653 17:47976674-47976696 GAGTGTTAGCTCATGGAAGATGG - Intronic
1149514151 17:57267315-57267337 AGGTGTCAGCTTAAGGAGGAGGG + Intronic
1150004222 17:61459889-61459911 CAGTGGTTGCTGAAGGAGGGGGG - Intronic
1151459840 17:74248083-74248105 CAGTGGCTCCTGAAGGAGGACGG + Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1153217238 18:2832098-2832120 CAGTGTGAGCTGAAACAAGAAGG - Intergenic
1153405395 18:4733054-4733076 CAGTCTTAGGGGAAGGAGAAGGG - Intergenic
1153491065 18:5648437-5648459 CAGTGAGAGCTGAAGGAGCCTGG + Intergenic
1154401622 18:14043552-14043574 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1157127670 18:44972418-44972440 CATTGGTAGCTTGAGGAGGATGG + Intronic
1157611568 18:48959893-48959915 CAGTGTTTGTTGTATGAGGAAGG - Intergenic
1158471303 18:57739364-57739386 CAGTGGTAGCAGGAAGAGGAGGG - Intronic
1159099306 18:63940528-63940550 GAGTGTAAGCTGAAGCAGGGTGG + Intergenic
1163216858 19:15885448-15885470 GAGTGTTTGCTGAATAAGGATGG + Intronic
1165480170 19:36058635-36058657 AAGTGTTAGCTGCTGGTGGATGG + Intronic
1166678936 19:44756041-44756063 CAGTGGTGGCTAAAGCAGGATGG + Intronic
1167037484 19:47002774-47002796 CAGTGTTAGCTCAAGCAGTGAGG - Exonic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
925838212 2:7966086-7966108 CAGTGTGAGCTCAAGGAGGTTGG - Intergenic
926534432 2:14093058-14093080 AAGTTTTAGCTAAAGGTGGAAGG + Intergenic
928392542 2:30920515-30920537 CAGTGTTAGCAGAAGGGGTTGGG + Intronic
928436746 2:31259443-31259465 CAGTAGGAGCTGAAGTAGGAGGG - Intronic
928464565 2:31511511-31511533 CACTGTTAGCTGAAGAAAAATGG + Intergenic
930595421 2:53381645-53381667 CAGGGGTAGCTGTAGGAAGAAGG - Intergenic
931550260 2:63436939-63436961 CAGTTATAGCTGGAGGGGGAGGG + Intronic
932094656 2:68837014-68837036 CAGTGTTAGCGTGAGGATGAGGG + Intergenic
932403074 2:71495662-71495684 CCATGTTAGCTGCAGGAAGATGG - Intronic
933269321 2:80216226-80216248 CAGTGTGAGCCGAAGCAGGGCGG - Intronic
933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG + Intergenic
933729654 2:85447088-85447110 CAGTGGTAGATGTAGGAGGCTGG + Intergenic
935392132 2:102564282-102564304 AAGTGTTTGTTAAAGGAGGACGG + Intergenic
935600186 2:104914691-104914713 TTGCTTTAGCTGAAGGAGGAGGG + Intergenic
936642495 2:114330571-114330593 CCCTGTGGGCTGAAGGAGGATGG + Intergenic
936859578 2:117001291-117001313 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937861235 2:126712176-126712198 CATTATTAGCTGAAGAAGAATGG - Intergenic
938097038 2:128471001-128471023 CACTGTTGGCTGGAGGAGGCTGG + Intergenic
939298764 2:140305198-140305220 CATTGTTAGCTTAATGGGGATGG + Intronic
939722296 2:145668924-145668946 AAGTATTAGCTTAAGGGGGAGGG - Intergenic
939744512 2:145952173-145952195 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
939746789 2:145981811-145981833 CAGAGTTATCTGAAAGAGAATGG - Intergenic
939944765 2:148396259-148396281 AAGCTCTAGCTGAAGGAGGAGGG - Intronic
940174228 2:150860939-150860961 CAATCATAGCTGAAGGCGGAAGG - Intergenic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
940644478 2:156376226-156376248 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
940727266 2:157348225-157348247 CAGTGATATGTGAAGGAGAAAGG - Intergenic
941751768 2:169141986-169142008 CAGTTTTAGCTGATGGGGAAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942854831 2:180532560-180532582 GAGTGTAAGCTGAAGCAGGGCGG - Intergenic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
946022495 2:216650642-216650664 CTGTGGTAGCTGCAGGTGGAGGG + Intronic
947570407 2:231229237-231229259 CAGCCTTAGCTGCAGGATGAGGG - Intronic
1169040855 20:2494136-2494158 CCGTGTTTGTTGAATGAGGAGGG - Intronic
1172456334 20:35077229-35077251 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1172819512 20:37718801-37718823 TAGTGTTGGCTGAAAGATGATGG + Intronic
1173464964 20:43273553-43273575 CATGGTTACCTGAAGGAGGGTGG - Intergenic
1173534640 20:43800196-43800218 GAGTGTTTGCTGAATGAGAATGG - Intergenic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1175704043 20:61162690-61162712 CAGTGCTTGCTGCAGGAGCAAGG + Intergenic
1176912444 21:14582402-14582424 TAGTGTTAGCACGAGGAGGAAGG - Exonic
1177846194 21:26290139-26290161 CAGTGTTGGCTGCAGAAGGTGGG + Intergenic
1177991997 21:28047953-28047975 CATTGTGAGCTCAAGGAAGAAGG - Intergenic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
1183422960 22:37723057-37723079 CAGTGAGACCTGTAGGAGGAGGG + Intronic
1183789113 22:40050597-40050619 CAGTCTTAACTGAGGGTGGATGG - Intronic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
950634909 3:14307828-14307850 CAGTATGTGCTGGAGGAGGAGGG - Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951368256 3:21812372-21812394 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
951940581 3:28074381-28074403 CATTGTTAGCTGATGTAGAATGG - Intergenic
952974807 3:38684711-38684733 CACTGTTACCAAAAGGAGGAAGG - Intergenic
953847636 3:46440707-46440729 CAGTGATTACTGAAGGAGGGAGG + Intronic
955484656 3:59423490-59423512 CAGTGACAGCTGAAGCAGAAAGG + Intergenic
955570082 3:60295397-60295419 CACTCATAGCTGAAGGAGAAGGG + Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
956601176 3:71024244-71024266 CAGTGACAGTTGAAGGAGAAAGG - Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
958484729 3:94690330-94690352 GAGTGTAAACTCAAGGAGGATGG + Intergenic
959687846 3:109167089-109167111 CACTGTTAGCTAAAGCATGAAGG - Intergenic
962425620 3:135266786-135266808 TAGTGTATGCTGGAGGAGGAAGG - Intergenic
963214800 3:142733095-142733117 CTGTGTTAGCTGTAGCAGGGTGG + Intronic
963306816 3:143662475-143662497 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
964507313 3:157413564-157413586 CTGTGTCACCTGAAGAAGGAGGG - Intronic
966111475 3:176407740-176407762 CAGTGTTTGCTGAAGGAATGAGG - Intergenic
966373122 3:179268887-179268909 CAGTGTGAGTTGCAGGAGCATGG + Intergenic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
968000510 3:195202572-195202594 CAGTGAAAGCTGAAGAAAGATGG - Intronic
968376078 4:42519-42541 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
968563424 4:1296647-1296669 GAGTAGTAGCTGGAGGAGGACGG - Intronic
969745390 4:9066896-9066918 AAGTTTTTGCTGAAGGTGGATGG - Intergenic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
971969495 4:33603715-33603737 CACAGGTAGCTGGAGGAGGATGG + Intergenic
973013477 4:45106793-45106815 CATTGGTAGCTTAATGAGGATGG + Intergenic
973112087 4:46409249-46409271 CAGTGGTAGCTTGATGAGGATGG - Intronic
973626118 4:52774128-52774150 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
973789000 4:54361546-54361568 GCCTGTGAGCTGAAGGAGGATGG + Intergenic
975305828 4:72847809-72847831 GAGTGTGAGCTGAAGCAGGGAGG + Intergenic
976328349 4:83798793-83798815 TAGTGGTGGCTGAAGCAGGAGGG - Intergenic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
977288696 4:95139901-95139923 CAGTGTGAGCCGAAGCAGGGTGG - Intronic
978110780 4:104961745-104961767 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
979280944 4:118866787-118866809 CAGTCGTGGCTGAAGGAGAAGGG - Intronic
982013163 4:151126417-151126439 CAGTGCTAGAAGAAGGAGGGTGG - Intronic
982159956 4:152558527-152558549 CAGAGATAGCTGAAGGGAGAAGG - Intergenic
984605505 4:181781164-181781186 CATTGGTAGCTTAATGAGGATGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985355789 4:189117191-189117213 CAGCATCAGCTGAAGTAGGAGGG - Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
989306215 5:39959763-39959785 CAATGATAGCAGAAGGATGAAGG - Intergenic
989418198 5:41205397-41205419 GAGTGTGAGCTGAAGAAGGGCGG + Intronic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
991952508 5:71960273-71960295 CAGTGGTGGCTGCATGAGGATGG - Intergenic
993147960 5:84120502-84120524 CTGTGTCATCTGAAGGAGTAAGG - Intronic
993546568 5:89220051-89220073 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
993742209 5:91555534-91555556 GAGTGTGAGCTGAAGGAGGGCGG + Intergenic
993888243 5:93442217-93442239 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
993939166 5:94038390-94038412 TACTGTTAGCTTAAGGAGGTGGG - Intronic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
998552471 5:143090673-143090695 CTGGGTTAGCTGATGGGGGAGGG + Intronic
999565903 5:152861213-152861235 CAGTGGTAGCTGAAAGGGAAGGG + Intergenic
1000338717 5:160260800-160260822 CAGGGTTGGCTGAGTGAGGAGGG - Intronic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1001684613 5:173584141-173584163 AAGTGTTAGCTGGAGTAGGGGGG + Intergenic
1002169391 5:177366877-177366899 CTGAGCTAGCTGAAGGAGGAGGG - Exonic
1002467616 5:179415516-179415538 CAGTTTTCACTGAATGAGGAAGG + Intergenic
1003091594 6:3108540-3108562 CAGTGTAAGCTGGAGGTGGTGGG + Intronic
1003584683 6:7376686-7376708 CAGAGTTGGAGGAAGGAGGAGGG - Intronic
1005346336 6:24894458-24894480 CACTCTTAGCTAAAGGAGAATGG - Intronic
1006214740 6:32430536-32430558 CAGTGTTTGCTGACTGAGGCGGG + Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007509071 6:42361771-42361793 CAGAGCTGCCTGAAGGAGGATGG - Intronic
1007697296 6:43741692-43741714 CAGTGTTGGCTGAAAGGGGCAGG + Intergenic
1009902534 6:69825839-69825861 CAGCTTTACCTCAAGGAGGATGG + Intergenic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010795549 6:80113285-80113307 CAGTGTTACCTGAAGGCCAAGGG - Intronic
1011221077 6:85055052-85055074 CCCTGTCAGCTGAAGGAGCAAGG - Intergenic
1011507445 6:88061949-88061971 CAATGTTAGCTGAGAGAGGGTGG - Intronic
1011984703 6:93428772-93428794 CAATGATAGCTGAGGGAGTAAGG - Intergenic
1013871182 6:114762811-114762833 CAGCGTTATCTGAAATAGGAGGG - Intergenic
1015458979 6:133466675-133466697 AAGAGTTAGGTGAAGAAGGAGGG + Intronic
1016291087 6:142528892-142528914 AAATGTGAGCTGAAGGGGGATGG - Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1017491587 6:154950325-154950347 CAGTCCTAGCTGGAGGAGAAGGG - Intronic
1018175837 6:161178595-161178617 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1020070765 7:5225553-5225575 CACTTTTAGCTGAAGTAGGATGG - Intronic
1023730226 7:43184837-43184859 CAGTGATAGCGGAAGGTGAAGGG + Intronic
1024266441 7:47610456-47610478 CAGAGTTAGATGAACAAGGAAGG - Intergenic
1028630086 7:92925197-92925219 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1030184033 7:106741926-106741948 CAGTTTTAGCAGAAGGATAAAGG - Intergenic
1031418062 7:121517144-121517166 CTGTGTTAGCTCATGGTGGAAGG + Intergenic
1032810747 7:135413953-135413975 TACTGTTAGTGGAAGGAGGATGG - Intronic
1033116136 7:138627142-138627164 CTGTGATAGCTGGAGGAAGATGG + Intronic
1033281136 7:140007258-140007280 AAGTGGTAACTGATGGAGGAGGG - Intronic
1033590621 7:142805336-142805358 CAGTGTTACCTGAGGAAGAATGG - Intergenic
1033808043 7:144976824-144976846 CAGTGCTAGCTGAAGCACTAAGG - Intergenic
1034820862 7:154215156-154215178 CAGTGATGGCGGAAGGTGGAAGG + Intronic
1035303263 7:157911851-157911873 CAGGGTTAGCAGAAGACGGAAGG - Intronic
1035558876 8:590031-590053 GAGTGTGAGCTGAAGAAGGGCGG - Intergenic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1038083434 8:24166041-24166063 CAGTTTTTCCTGAAGGTGGAGGG + Intergenic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038474390 8:27854207-27854229 CAGTGTTTGCTGAAGGTAAATGG - Intergenic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1039390673 8:37178791-37178813 CAGTGCTCAGTGAAGGAGGAGGG + Intergenic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041997661 8:64083819-64083841 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1043048818 8:75359823-75359845 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1043790481 8:84460988-84461010 CAGTGTTTGCTAAAGGTGGTAGG + Intronic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1044633926 8:94303685-94303707 GAGTGTTTGGTGAAGGAGAAGGG - Intergenic
1044668359 8:94653854-94653876 CCTTGTTAGCTGGAGGTGGAAGG + Intronic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1048172662 8:132122591-132122613 CAGTGCTATCTGGAGGATGAAGG + Exonic
1048349237 8:133602611-133602633 CAGTGATAGCAGAAAGAAGAGGG + Intergenic
1048426588 8:134329156-134329178 CCGTGGTAGCTGCTGGAGGAGGG - Intergenic
1049412878 8:142481268-142481290 CGGTGTGAGCTGGACGAGGAAGG + Exonic
1050521943 9:6510035-6510057 CAGTGTAAGCTCAAGGTGAACGG - Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1053218476 9:36292429-36292451 CAATGTTAGGAGAAGGATGAAGG - Intronic
1054800658 9:69345154-69345176 AAGTGTCAGGTGAAGGAGGCTGG + Intronic
1054887304 9:70212592-70212614 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057363930 9:94400878-94400900 CAGTGGTAGCTGGAGTTGGAGGG - Intronic
1057659406 9:96987188-96987210 CAGTGGTAGCTGGAGTTGGAGGG + Intronic
1058413459 9:104760860-104760882 AAGTATTAGCTGAAGGATGGTGG - Intergenic
1059217203 9:112575148-112575170 CTGTGTTAACTGAGGGAGAAAGG - Exonic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1061552430 9:131345363-131345385 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1203573148 Un_KI270744v1:151631-151653 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1186864005 X:13701204-13701226 CAGTGGCAGGTAAAGGAGGAGGG - Intronic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191972260 X:66829596-66829618 CAGTTTTAGCCCAGGGAGGATGG - Intergenic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1194702719 X:97134115-97134137 CAGTTTTAGGTGAAGGATGAAGG + Intronic
1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG + Intergenic
1195002266 X:100653276-100653298 TAGTGTTATCAGAAGTAGGAAGG - Intronic
1198252484 X:134893569-134893591 CAGTGTTAGCTCTAGGAGGGTGG - Intronic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1200798137 Y:7360708-7360730 CAGTGATAGCTGAAGGGTGCAGG - Intergenic
1201353867 Y:13076345-13076367 CATTGGTAGCTTAATGAGGATGG - Intergenic
1201393147 Y:13520269-13520291 GAGTGTGAGCTGAAGCAGGCAGG - Intergenic
1201479555 Y:14425066-14425088 CATTTTTAGCTGAGGCAGGAGGG - Intergenic
1201776194 Y:17668552-17668574 GAGTGTGAGCTGAAGAAGGGTGG - Intergenic
1201825362 Y:18237440-18237462 GAGTGTGAGCTGAAGAAGGGTGG + Intergenic