ID: 1064358991

View in Genome Browser
Species Human (GRCh38)
Location 10:14646342-14646364
Sequence CTGGAGACTCAGGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1076
Summary {0: 1, 1: 2, 2: 19, 3: 160, 4: 894}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064358991_1064359001 24 Left 1064358991 10:14646342-14646364 CCTCCCTCCTCCTGAGTCTCCAG 0: 1
1: 2
2: 19
3: 160
4: 894
Right 1064359001 10:14646389-14646411 CCATCGCTTAGCTCCCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064358991 Original CRISPR CTGGAGACTCAGGAGGAGGG AGG (reversed) Intronic
900118889 1:1040318-1040340 CTGGAGGCCCACGAGGTGGGTGG + Intronic
900395107 1:2450282-2450304 CTGGAGGCCCACGGGGAGGGAGG - Intronic
900550066 1:3250182-3250204 CTGGAGCCTCAGGAGCAATGCGG - Intronic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901681696 1:10916508-10916530 CTGGTGACAGAGGAGCAGGGTGG - Intergenic
902205531 1:14865625-14865647 CTGGAGAGCAAGGGGGAGGGTGG - Intronic
902231105 1:15028200-15028222 GTGGGGACTCTGGAGGTGGGAGG - Intronic
902242859 1:15100319-15100341 CAGGACCCTCAGCAGGAGGGTGG + Intronic
902263831 1:15247281-15247303 CTGGAGACTCCGCGGGAGCGCGG + Exonic
902314328 1:15606508-15606530 CTGGAGAATGAGGGAGAGGGAGG - Intergenic
902657880 1:17881983-17882005 CTGCAGGCAGAGGAGGAGGGTGG + Intergenic
902703912 1:18191483-18191505 CTGAAGACTCTGGGGGAAGGAGG + Intronic
902817606 1:18925246-18925268 CAGGAGGCTGAGGAGGAGAGAGG - Intronic
902902603 1:19529877-19529899 CAGGAGACTGGGGAGGAGCGTGG - Intergenic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903878233 1:26490856-26490878 CTGGAGACTGGGGTGGAGGTTGG + Intergenic
904331466 1:29760627-29760649 CAGGAGACTCCAGAAGAGGGTGG - Intergenic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
905212819 1:36385979-36386001 CTGGAGACGCAGGCGGAGGGCGG - Intergenic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
905695062 1:39967932-39967954 CTGGAGATACCCGAGGAGGGGGG - Intronic
905856914 1:41320401-41320423 GTGGAGACTCAGGAGAGGAGGGG + Intergenic
905888127 1:41502667-41502689 CTGGAGACTCCGGTGGGGTGTGG - Intergenic
906239991 1:44236960-44236982 CTGGAGTCCCTGGAGGAGGTGGG - Intronic
906513749 1:46425973-46425995 CTGGTGACTTGGCAGGAGGGTGG + Intergenic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
908194075 1:61731717-61731739 CAGGAGGCTTAGGCGGAGGGTGG - Intergenic
908354474 1:63317221-63317243 CTGGAGACTCCCGGGGCGGGTGG + Intergenic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
909872202 1:80755732-80755754 TTGGAGACTCAGGAGGTTGGGGG - Intergenic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
911084705 1:93966668-93966690 CTGGAGACTCAGGAGGCACCTGG - Intergenic
912493587 1:110076826-110076848 CTGGAGACTCCAGAGGAGTCTGG - Intergenic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
912978202 1:114348522-114348544 CTGAAAACTCAGGATGAAGGCGG + Intergenic
913099395 1:115549379-115549401 GTAGAGACACAGAAGGAGGGGGG + Intergenic
913536229 1:119775316-119775338 CTGGAGCCTGAGGTGGAGGATGG + Intergenic
914379357 1:147102670-147102692 CTGCGTCCTCAGGAGGAGGGAGG - Intergenic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
914802526 1:150971995-150972017 CTGGAGTCGCAGAGGGAGGGTGG + Intronic
914846483 1:151286587-151286609 CTGGAGGCTCAGCAGGAGACGGG + Exonic
914949395 1:152099139-152099161 CTGAAAACTCAGAAGCAGGGAGG + Intergenic
915098202 1:153478987-153479009 CTGGAGACTAGGGAGGAGGAAGG - Intergenic
915135556 1:153728717-153728739 CAGGAGCCCCAGGAGGGGGGAGG + Exonic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916043170 1:160978691-160978713 TGGGAGGCTGAGGAGGAGGGAGG + Intergenic
916247104 1:162699080-162699102 CGGGAGATTCAGGAGAAGGCTGG + Intronic
916402683 1:164466169-164466191 CTTGAGTAACAGGAGGAGGGAGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916738371 1:167628122-167628144 CTGGGGACCCAGGAGCATGGTGG + Intergenic
917038924 1:170780709-170780731 CTGGACATTGAGGAAGAGGGAGG + Intergenic
917422897 1:174883408-174883430 CTGGAGACGCAGGAGGAGTTGGG + Intronic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919416966 1:197322732-197322754 TTGCAGAGTCAGGAGGAGTGGGG - Intronic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920164598 1:204026600-204026622 CTGGAGACAAAGGCAGAGGGAGG + Intergenic
920291027 1:204923325-204923347 CTGGAGTGGGAGGAGGAGGGAGG - Intronic
920295658 1:204954641-204954663 CTTGAGAGGCAGGAGAAGGGAGG - Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920904684 1:210151076-210151098 CAGAAGACTCAGGGGGAAGGAGG + Intronic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
921144487 1:212340193-212340215 CTGGATCCTCAGGAAGAGGATGG - Intronic
921172333 1:212560645-212560667 CTGGAGACTGGGGAGGGGAGAGG - Intergenic
921636431 1:217500285-217500307 CTGGAGGCTGAAGAGGAGGGAGG - Intronic
922155616 1:223038124-223038146 CTGGAGGCCTGGGAGGAGGGAGG - Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922461459 1:225817167-225817189 CTGGAGACTCAGGATGGAAGAGG - Intronic
922563667 1:226587282-226587304 CAGGAGACTGAGGGGGATGGAGG + Intronic
922614168 1:226951351-226951373 CTGAAGCGACAGGAGGAGGGAGG + Intronic
923106052 1:230854788-230854810 CAGGAGACCTATGAGGAGGGTGG - Intronic
924427119 1:243962073-243962095 CTGAAGATTGAGGATGAGGGTGG + Intergenic
1063034889 10:2276653-2276675 CTGGAGAAGCAGGAGTATGGTGG - Intergenic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1065661039 10:28004421-28004443 CTGGATCATCAGGAAGAGGGAGG - Intergenic
1066173198 10:32874439-32874461 CTGGAGGCTCAGAAGGGGAGAGG - Intronic
1066481282 10:35798104-35798126 CAGGAGCCTGATGAGGAGGGCGG + Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1067010882 10:42712521-42712543 TTGGAGACTCATAAGCAGGGAGG - Intergenic
1067065413 10:43101563-43101585 CTGGAGGCTCAGGATGAAGAGGG - Intronic
1067234850 10:44438961-44438983 CTGTAGGCTCTGGGGGAGGGTGG + Intergenic
1067766979 10:49094196-49094218 CTGGAGCCTCAGAAGCAGTGGGG + Intronic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068833615 10:61526666-61526688 CTGGAGACTCAGGAGGGTGCAGG + Intergenic
1068905412 10:62316774-62316796 CAGGAGACAAAGGAGGATGGGGG - Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071521278 10:86332690-86332712 GTGAAGCCTCAGGAGGAGAGGGG - Intronic
1071522736 10:86341135-86341157 CTGAACAATAAGGAGGAGGGAGG - Intronic
1071629652 10:87208042-87208064 CTGGAGTCTTAGAAGAAGGGAGG + Intergenic
1071811801 10:89190139-89190161 TTGGGGACTCTGGAGGTGGGGGG - Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072699927 10:97633319-97633341 CTGGAGGCGCAGGAGGGAGGGGG - Intronic
1072747982 10:97955181-97955203 CTGGTGAATCTGAAGGAGGGTGG - Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073287196 10:102396143-102396165 CTTGGGTCTGAGGAGGAGGGGGG + Intronic
1073517860 10:104094271-104094293 CTTGAACCTCAGGAAGAGGGAGG - Intergenic
1074720858 10:116263967-116263989 CTGGAGATCCAGGAAGAGAGAGG + Intronic
1074994979 10:118748948-118748970 AAGAAGAGTCAGGAGGAGGGAGG + Intronic
1075274607 10:121081859-121081881 CTGGGGACACTGGAGGAGAGAGG + Intergenic
1075551974 10:123399692-123399714 CGGGAGGCGCAGGAAGAGGGGGG - Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1075761024 10:124856774-124856796 CTGGAGCCTCAGGAAGGGAGGGG - Intergenic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1075995643 10:126874093-126874115 CTGGAGTTCCAGGAGGAGGTGGG - Intergenic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076403912 10:130200316-130200338 CTGGGGGCTCAGGAGGGGAGGGG - Intergenic
1076755229 10:132567079-132567101 CTGGAATGTCTGGAGGAGGGAGG + Intronic
1076768917 10:132652355-132652377 CTGCAGCCCCAGGAGGAGCGGGG + Intronic
1076804482 10:132848421-132848443 CTGGTGAGTCGGGGGGAGGGAGG + Intronic
1076813578 10:132902207-132902229 CTGGAGTCTCAGGAGGACAGAGG - Intronic
1076826231 10:132971023-132971045 CTCCATGCTCAGGAGGAGGGAGG + Intergenic
1076921284 10:133455953-133455975 CTGCAGACCCAGGAGGACAGGGG + Intergenic
1076931503 10:133534687-133534709 CAGCAGCTTCAGGAGGAGGGCGG - Intronic
1077076282 11:703629-703651 CTGGAGACGCAGGATGGGGTAGG + Intronic
1077159352 11:1105650-1105672 GTGGACACCCAGGAGGAGGCAGG - Intergenic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1077485759 11:2837722-2837744 CTGGAGGCTAAGGAGAGGGGTGG + Intronic
1077533605 11:3108454-3108476 CTGGAGTCCAGGGAGGAGGGTGG + Intronic
1077914736 11:6603856-6603878 CTTGGGACTCAGGAGAAGTGAGG - Exonic
1078106537 11:8361473-8361495 CTGGAGAGTGAGCAGGTGGGTGG - Intergenic
1078338325 11:10481491-10481513 CAGGAGACACAGGAGGAGTTAGG - Intronic
1078884824 11:15489861-15489883 CTTGAGGCTCAGGCGAAGGGTGG - Intergenic
1079011572 11:16832901-16832923 CTGCAGTCTCAGGAATAGGGTGG + Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079386667 11:19986181-19986203 CTGGAGATGGAGGATGAGGGTGG + Intronic
1079545614 11:21628880-21628902 CTAGAGACTCAGGAGGCCCGGGG + Intergenic
1080230230 11:30012191-30012213 CTGCTGCCTCAGGATGAGGGCGG - Exonic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080798858 11:35590637-35590659 CTATAGCATCAGGAGGAGGGAGG - Intergenic
1081026129 11:38017428-38017450 CTGTAGACTCAGGAGTAGGTGGG - Intergenic
1081048702 11:38310546-38310568 CTAGAGCCTCAGAAGGAGCGTGG + Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1081461514 11:43276617-43276639 TTGGGGACTCAGGGGAAGGGAGG - Intergenic
1081526280 11:43929946-43929968 AGAGAGACTGAGGAGGAGGGTGG + Intronic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083599483 11:63938148-63938170 CTGGAGATTCTGGGGGAGGTTGG + Intergenic
1083757959 11:64801595-64801617 CTGGAGAGTGAGGAGAAGGTTGG + Exonic
1083814674 11:65125921-65125943 AGGGGGCCTCAGGAGGAGGGAGG + Exonic
1084188933 11:67490222-67490244 CTGGAGGCTGAGGGGGAGGATGG + Intronic
1084370079 11:68735439-68735461 CTACAGAGTCAGGAGGAGGCCGG + Intronic
1084502907 11:69545458-69545480 CTGGAGGCTCAGGAGAGGAGGGG - Intergenic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1084819779 11:71678241-71678263 TTGGGGACTCAGGGGGAAGGTGG + Intergenic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1084942808 11:72622687-72622709 CTGGAGACAGAGGAGGATGGGGG + Intronic
1085191984 11:74634626-74634648 GTGGAGACGGAGGAGGAGGTGGG - Exonic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085810345 11:79674968-79674990 CTGGAGACTCACGTGGTAGGAGG - Intergenic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1086772469 11:90784499-90784521 CTGGAGACTCAGGTTGAATGAGG + Intergenic
1088363300 11:109013409-109013431 CTGTGGACTCAGGAGGTGTGCGG + Intergenic
1088532570 11:110826775-110826797 CTGGAGACTCATGAGAACCGAGG - Intergenic
1089157596 11:116414229-116414251 CTTGAGAATCTGGAGGAAGGTGG - Intergenic
1089573281 11:119423601-119423623 CTGGAGGCTCCGGAGGAGGTGGG - Exonic
1089581422 11:119483967-119483989 CTAGAGCCGCAGGAGGCGGGAGG - Intergenic
1090435772 11:126685223-126685245 CTGGGGAGTCAGGGGCAGGGCGG + Intronic
1090458467 11:126869393-126869415 CTGGAGACACTGCAGGAGAGTGG - Intronic
1090643516 11:128748784-128748806 ATGGAGACTCATGAGGTGAGGGG + Intronic
1090855071 11:130603691-130603713 GTGGAGACTCAGGATGATGGTGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091131609 11:133151403-133151425 CTGGAGATGCAGGAAGATGGGGG + Intronic
1091344235 11:134842263-134842285 CGGGACAATCAGCAGGAGGGAGG + Intergenic
1091381344 12:63439-63461 CTGGGGACTTGGGAGAAGGGTGG + Intergenic
1091800955 12:3324151-3324173 CTGGGACCACAGGAGGAGGGAGG + Intergenic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092213329 12:6662773-6662795 CTGGAGACCCTGGAGAATGGGGG + Intronic
1092223306 12:6730119-6730141 CAAGAGACTGAGGTGGAGGGTGG - Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1092999825 12:13983714-13983736 CTGGAAACTGAAGAGGAGTGTGG - Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094591267 12:31823214-31823236 TTGGAGACTCAGGAAAAGGTGGG - Intergenic
1095226336 12:39681306-39681328 CTGGGGACTCTGGTGGAGGGTGG + Intronic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1096474394 12:51899288-51899310 CCCGAGACTCAGGAAGAGGCTGG - Intergenic
1096607474 12:52777037-52777059 CTGGAGGCTTTGGGGGAGGGCGG - Exonic
1096610170 12:52795791-52795813 CTGGAGGCTTTGGGGGAGGGCGG - Exonic
1096681736 12:53260123-53260145 CTGGAGGCTGAGGTGGAGGTGGG - Intergenic
1096736415 12:53658960-53658982 CTGGGGACTCAGGAGGCCTGAGG - Intronic
1097234069 12:57527995-57528017 CTGGAGACTCTGTAGCAGGCAGG - Exonic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097961183 12:65533395-65533417 CAGCAGAGACAGGAGGAGGGAGG - Intergenic
1098003538 12:65970771-65970793 CTGAAGACTGAGGAGGAGGTTGG - Intergenic
1098037934 12:66325360-66325382 CTGGAGACTCAGGCAGGGAGGGG - Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098500105 12:71182168-71182190 TTGGAGACTTAGGATGGGGGAGG + Intronic
1100776334 12:97979162-97979184 CTTAAGACTCAGGAGGTGTGTGG - Intergenic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101680015 12:106955803-106955825 CTGGAGCCGCGGGAGGAGGCGGG + Exonic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102719475 12:115003703-115003725 GTGGAGGCCCAGGAGGAGAGTGG - Intergenic
1102755635 12:115337828-115337850 CAGGAAACTCATGAGTAGGGAGG + Intergenic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1102934465 12:116884828-116884850 CTGGGGACTTGGGAAGAGGGAGG + Intergenic
1103343223 12:120232378-120232400 CTGGGACCTCTGGAGGAGGGAGG - Intronic
1103707302 12:122883941-122883963 CTGGAGACCTTGGAGGAAGGAGG + Intronic
1104072301 12:125356436-125356458 CTGAACACCCAGGAGGAAGGTGG - Intronic
1104291620 12:127474544-127474566 CTAGAGACTCTGGAGGTGGCTGG - Intergenic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1104924702 12:132308162-132308184 CTGGAGCCCCAGGAGCTGGGAGG + Intronic
1104942047 12:132399767-132399789 CTGGAGACTCAGGCGTTGGAGGG - Intergenic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1105797376 13:23868653-23868675 GTGGTGAGTCAGGAGTAGGGTGG - Intronic
1106568812 13:30908563-30908585 CTCGGGAATCAGGAGGTGGGAGG + Intronic
1106572690 13:30941651-30941673 ATGGAGACTCAGAAGCAGAGAGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106763711 13:32893080-32893102 CTGGAGACACTGGAGGCAGGGGG - Intergenic
1107581687 13:41795781-41795803 CTGGAGCCTCTTGAGGTGGGCGG + Intronic
1107884739 13:44865975-44865997 ATTGAGACTCAGGGGTAGGGCGG - Intergenic
1107959191 13:45543621-45543643 TTGGAGCCTCTGGAGGATGGTGG + Intronic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1110754174 13:79152300-79152322 TTGGAGAAAAAGGAGGAGGGTGG - Intergenic
1110796944 13:79649952-79649974 TTGGAGACTCGGAAGTAGGGAGG - Intergenic
1111164542 13:84441853-84441875 TTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1111823054 13:93236388-93236410 CCGGAGACTAAGAAGTAGGGAGG - Intronic
1111976117 13:94968379-94968401 CTGGAGACCCGGGAGGAGCGAGG + Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113091744 13:106624145-106624167 CTGGAGACTGAGGACCAGAGAGG - Intergenic
1113117224 13:106886334-106886356 GTGGAGCCTCAGCAGGAGTGTGG - Intergenic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1113843089 13:113371423-113371445 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843097 13:113371443-113371465 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843106 13:113371463-113371485 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843113 13:113371482-113371504 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843122 13:113371502-113371524 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843130 13:113371522-113371544 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843139 13:113371542-113371564 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843147 13:113371562-113371584 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843156 13:113371582-113371604 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843164 13:113371602-113371624 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843173 13:113371622-113371644 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843181 13:113371642-113371664 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843190 13:113371662-113371684 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843198 13:113371682-113371704 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843213 13:113371721-113371743 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843221 13:113371741-113371763 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843229 13:113371761-113371783 GAGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843237 13:113371780-113371802 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843258 13:113371839-113371861 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843267 13:113371859-113371881 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843276 13:113371879-113371901 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113962385 13:114133006-114133028 CTGCAGACGCACGAGGGGGGCGG + Intergenic
1114489672 14:23091480-23091502 CTGGCTACTCAGGAGGTGGTGGG + Intronic
1114556301 14:23564256-23564278 CAGGAGGCTCTGGAGGAAGGAGG + Intronic
1114674712 14:24432283-24432305 GTGGAGCCGCTGGAGGAGGGAGG - Exonic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115371366 14:32618351-32618373 TTGGCGACTCAGAAGCAGGGAGG - Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116693851 14:48147220-48147242 CTGGAGACTCAGAAGGGCAGAGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1116941760 14:50797926-50797948 TGGGAGACTGAGGAGGAGGAGGG + Intronic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1119232233 14:72989442-72989464 CTACAGACTGAGGAGGGGGGAGG + Intronic
1119670899 14:76517595-76517617 CTGGGGATTGAGGAGGAGTGAGG - Intergenic
1119749625 14:77068163-77068185 TTGGAGAATCTGGAGAAGGGTGG - Intergenic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120208267 14:81609176-81609198 ATGGTGACTCAGGGGGCGGGAGG + Intergenic
1121080412 14:91103397-91103419 ATGGAGACGGAGGAGGAGGGAGG - Intronic
1121223281 14:92302413-92302435 CTGGAGGCTGAGGTGGAGGATGG + Intergenic
1121485086 14:94308546-94308568 ATGCAGACTCAGAAGCAGGGGGG - Intronic
1121712957 14:96052857-96052879 CAGTTGACTCAGGAGGAGAGTGG + Intronic
1122218467 14:100219989-100220011 CTGGAGACTCTGGAGTAGCTGGG + Intergenic
1122220792 14:100238413-100238435 CGGGAGCCTGAGGAGAAGGGAGG - Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122292755 14:100688366-100688388 GCGGAGCTTCAGGAGGAGGGAGG - Intergenic
1122397224 14:101442009-101442031 CAGGAGACGCAGGTGGCGGGGGG - Intergenic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1122797969 14:104215929-104215951 CTGGAGCCACATGAGGAGGTAGG - Intergenic
1123448172 15:20344532-20344554 CTGGAGACTAAGGAGAAGCAAGG - Intergenic
1124064913 15:26333387-26333409 CTGGAGACTCTAAAGGATGGGGG + Intergenic
1124124614 15:26928285-26928307 CTAGTGACTCAGGATGAGCGTGG + Intronic
1124327866 15:28782984-28783006 CCGGAGGCCCAGGAGGCGGGCGG - Intergenic
1124346846 15:28928734-28928756 CTGGTGACTCTGGCAGAGGGAGG - Intronic
1125589280 15:40844421-40844443 CGGGAGACTTTGGAGGAGGCGGG - Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126382147 15:48059960-48059982 CTGGAGTCTCAGGACGGGGAGGG - Intergenic
1126470976 15:49010287-49010309 CTGGAGAATCAGGAGTGGTGTGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127046335 15:55029435-55029457 TTGGAGGCTGAGGAGGTGGGAGG + Intergenic
1127456398 15:59159475-59159497 CTGGAGTGTCAGGAGGGAGGTGG + Intronic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1128345441 15:66850007-66850029 CTGGAGGCTGAGGAGCAGGCTGG - Intergenic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1128555453 15:68628768-68628790 ATGTAGACTCCGGAGGAGGCAGG - Intronic
1128691618 15:69728440-69728462 TTGAAGACTCAGAAGCAGGGAGG - Intergenic
1128809347 15:70559378-70559400 CTGGAGACAGAAGGGGAGGGAGG + Intergenic
1129829915 15:78661946-78661968 CTGGGGCTTCAGGGGGAGGGAGG - Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130076881 15:80696540-80696562 CTGGAGCGTCAGGTGGAGCGGGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130567476 15:85008864-85008886 CTCGAGACACAGGGAGAGGGAGG - Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131429181 15:92372800-92372822 GTGGAGTCTCACGAGGTGGGTGG - Intergenic
1131778591 15:95829231-95829253 ATGGCGGCTCAGGAAGAGGGAGG - Intergenic
1132310326 15:100852898-100852920 GTGGGGGCTCAGGGGGAGGGTGG - Intergenic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132342455 15:101087044-101087066 CTGGAGACAGAGGAGAAGGAGGG + Intergenic
1132587916 16:714373-714395 GTGGAGACACAGGAGCTGGGAGG - Intronic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132763525 16:1523108-1523130 CCGGCTACTCAGGAGGAAGGAGG + Intronic
1132819928 16:1859910-1859932 CTGGAGCCTCAGCAGGAGCCGGG - Intronic
1132839938 16:1974004-1974026 CTGGGGACTGAGGGGGTGGGTGG + Intronic
1132843355 16:1989341-1989363 GGGGAGACCCAGGAGTAGGGAGG + Intergenic
1132871445 16:2117395-2117417 GGGGAGTCTCAGGAGGAAGGAGG - Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1132936452 16:2483702-2483724 CTGGAGAGAGAGGAGGCGGGTGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133578486 16:7118412-7118434 TCAGAGACTCAGAAGGAGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133712036 16:8410780-8410802 TTGGAGACTCAGAAGCAGAGAGG + Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134081354 16:11327214-11327236 ATGGAGAGGCAAGAGGAGGGAGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1134314446 16:13105563-13105585 GGGGAGACTCCGGAGGAGGGAGG + Intronic
1134346503 16:13396821-13396843 ATGGGGACTCATGGGGAGGGAGG - Intergenic
1134371860 16:13633367-13633389 TTGGAGGCTCTAGAGGAGGGTGG - Intergenic
1134478469 16:14596635-14596657 CAGGAGGCTAAGGAGGAGGGAGG + Intronic
1134521083 16:14919499-14919521 GGGGAGTCTCAGGAGGAGGGAGG + Intronic
1134550488 16:15136473-15136495 GGGGAGTCTCAGGAGGAGGGAGG - Intronic
1134708759 16:16318150-16318172 GGGGAGTCTCAGGAGGAGGGAGG + Intergenic
1134715973 16:16358184-16358206 GGGGAGTCTCAGGAGGAGGGAGG + Intergenic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1134950846 16:18350495-18350517 GGGGAGTCTCAGGAGGAGGGAGG - Intergenic
1134958783 16:18393975-18393997 GGGGAGTCTCAGGAGGAGGGAGG - Intergenic
1135059001 16:19255141-19255163 TGGGAGACTCAGGAGCAGGTGGG - Intronic
1135138042 16:19899102-19899124 CTCCACCCTCAGGAGGAGGGAGG - Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135282828 16:21167427-21167449 GTGGAGCCTAAGGAGGAGAGGGG + Intronic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1135516655 16:23141214-23141236 CTAGAGAGCCAGGAGGAGAGCGG - Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136113966 16:28082963-28082985 CTGGAGCCTCCGGAGGGAGGTGG - Intergenic
1136297050 16:29309577-29309599 CTTGGGAGTCAGGAGGAGCGGGG + Intergenic
1136349064 16:29695256-29695278 CTGGAGGCTCTGGAGAGGGGAGG - Intronic
1136555994 16:31008238-31008260 CTGGAGATTCAAGAGGGGGCGGG - Intronic
1136656211 16:31710851-31710873 CTGGGGTCCCAGGAGGATGGTGG - Intergenic
1136705966 16:32188218-32188240 CGGGAGAGTCAGGAGGAGCAGGG - Intergenic
1136761947 16:32741187-32741209 CGGGAGAGTCAGGAGGAGCAGGG + Intergenic
1136806153 16:33129201-33129223 CGGGAGAGTCAGGAGGAGCAGGG - Intergenic
1137519226 16:49177948-49177970 CTGGAGACTCTGGGGCTGGGGGG + Intergenic
1137565866 16:49532224-49532246 CTGGAGACTCTGACGGTGGGTGG + Intronic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1139069709 16:63365110-63365132 CTGGAGGCTGACGAGGTGGGAGG + Intergenic
1139598421 16:67971263-67971285 CTGCAGCCTCAGGGGTAGGGTGG + Intergenic
1139956255 16:70694427-70694449 CTGGAGACAGAAGAGCAGGGGGG - Intronic
1140339859 16:74146849-74146871 TGGGAGGCTCAGGAGGAGGAGGG - Intergenic
1140515740 16:75539960-75539982 CTGAAGACTCAGCAGGACCGTGG - Exonic
1140532804 16:75681713-75681735 TTGGGGACTCAGGGGAAGGGTGG - Intronic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141270990 16:82541123-82541145 AGGGAGAGTCAGGAGGAGGGAGG + Intergenic
1141439448 16:84020247-84020269 CAGGAGGCTGAGGAGGAGGGAGG - Intronic
1141527202 16:84618756-84618778 CTGCAGCCTCAGGGGCAGGGGGG - Intergenic
1141775785 16:86121837-86121859 CGGGACAAGCAGGAGGAGGGAGG - Intergenic
1141986396 16:87583007-87583029 TTGGAGGCTCAGGAGGAGGTGGG + Intergenic
1142018508 16:87765598-87765620 GTGGAGACTCAGGAGGGGGCGGG + Intronic
1142034456 16:87854890-87854912 GTGGAGACACAGGTGAAGGGAGG - Intronic
1142058600 16:88015681-88015703 CTTGGGAGTCAGGAGGAGCGGGG + Intronic
1142112192 16:88338862-88338884 CTGGAGCCTCAGGAGGAGCGTGG + Intergenic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1142198604 16:88750532-88750554 CCGGACTCTCAGGATGAGGGTGG - Intronic
1142421467 16:89972926-89972948 TTGGAGACGGAGGAGGCGGGGGG - Intergenic
1203064105 16_KI270728v1_random:1001503-1001525 CGGGAGAGTCAGGAGGAGCAGGG + Intergenic
1142506333 17:365599-365621 CTGGGGACTGTGGAGAAGGGAGG - Intronic
1142627399 17:1200997-1201019 ATGGAAACTAAGGAGGATGGGGG + Intronic
1143564010 17:7710571-7710593 CTGGGGGATCAGGAGGTGGGAGG + Exonic
1144342297 17:14319924-14319946 TTGGGGACTCGGGGGGAGGGTGG - Intronic
1145978616 17:28998412-28998434 CTGGGGACCCAGGGGTAGGGAGG + Intronic
1146370211 17:32261429-32261451 CTGGAGATGGAGGTGGAGGGTGG + Intergenic
1146669231 17:34725273-34725295 CTGGAGGCTCAAGAGGAGTAGGG + Intergenic
1146915354 17:36674905-36674927 CTGGGGACTCAGGGAAAGGGCGG + Intergenic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147162875 17:38578284-38578306 CTGGAGCCTGGGGAGGAAGGGGG - Intronic
1148018696 17:44539788-44539810 GAGGAGACTGGGGAGGAGGGAGG + Intergenic
1148019935 17:44547101-44547123 ATGGAGGCTCAGGAGAAGGGGGG + Intergenic
1148036650 17:44668446-44668468 CTAGCTACTCAGGAGGAGGAAGG - Intronic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148331144 17:46814710-46814732 CTGGAGACTGCGGGGGAGGAAGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148561599 17:48609894-48609916 CTAGAGAGGCAGGTGGAGGGAGG - Intronic
1149170559 17:53805342-53805364 GAGGAGAGTCAGGAGTAGGGAGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1151317889 17:73335148-73335170 CTGGAGCCCTAGGAGGATGGTGG + Exonic
1151382250 17:73733991-73734013 CTGGAGCCCCAGGAGCAAGGAGG - Intergenic
1151470193 17:74313281-74313303 CTTTAGACCCAGGGGGAGGGAGG - Intronic
1151699952 17:75737706-75737728 CTGGGGACCCTGGTGGAGGGTGG - Intronic
1151800538 17:76376879-76376901 CTGGATACTCGTGAGGAGAGAGG - Intronic
1152037134 17:77880421-77880443 CTGGAGCCCAAGTAGGAGGGAGG - Intergenic
1152175204 17:78782448-78782470 CCGGAGCCTCGGGAGGAGGCCGG - Intergenic
1152340623 17:79722048-79722070 CTGGAGACTAAGGAGAAGCAAGG + Intergenic
1152390877 17:80003011-80003033 CTGGGGATTCAGCAGGAGAGAGG + Intronic
1153084962 18:1274762-1274784 CTGGAGACACAAGAGAAAGGGGG + Intergenic
1153201999 18:2656115-2656137 GTGGGGACTGAGGAGGATGGCGG + Exonic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1153925160 18:9828989-9829011 CTGCTGTCACAGGAGGAGGGAGG + Intronic
1154055504 18:11009443-11009465 CTGGAGATTCAGCTGAAGGGAGG + Intronic
1154226549 18:12510194-12510216 CTAGAAACTGGGGAGGAGGGAGG + Intronic
1154306464 18:13234230-13234252 GAGGAGCCTCAGCAGGAGGGAGG - Intronic
1154491876 18:14928637-14928659 CTGGAGACTCAGGAGACCAGTGG - Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155641321 18:28019129-28019151 TTGGAGACTCAGGGAAAGGGTGG + Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156469378 18:37367947-37367969 CAGCAGAGTCAGGGGGAGGGTGG + Intronic
1157625308 18:49045786-49045808 CTGGAGGCTAAGGAGGGGGTGGG + Intronic
1157879392 18:51305366-51305388 CTGGAGACTCAGGGGCCAGGGGG + Intergenic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158598761 18:58839110-58839132 ATGAGGACTCAGGTGGAGGGGGG - Intergenic
1158692951 18:59677630-59677652 CAGGATACTCAGGAGGCAGGAGG + Intronic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158789966 18:60767216-60767238 CTGGAGATTCAGGGGCAGAGAGG + Intergenic
1158803465 18:60942034-60942056 TGGGAGACTGAGGAGGTGGGTGG + Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158893293 18:61893109-61893131 GGGGAGACTGCGGAGGAGGGGGG - Exonic
1159333190 18:67029014-67029036 CTGGAGGCTGAGGAGGAGAATGG - Intergenic
1159681149 18:71354207-71354229 CTGGAGGCTCAGCAGGAGAGTGG - Intergenic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1160064060 18:75558546-75558568 CTGGAGCCTCAGTGGTAGGGTGG + Intergenic
1160076791 18:75684989-75685011 TTGGAGGCTCAGGAGCAGTGGGG + Intergenic
1160870888 19:1277345-1277367 CTGGAGACTCAGCAGGACCCTGG + Intronic
1161145846 19:2677656-2677678 CTGGAACCTCAGGAGGACAGAGG + Intronic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1161642881 19:5435417-5435439 CTGGAACCACAGGAGGAGTGAGG - Intergenic
1161660704 19:5544189-5544211 CTGGCGGTTCAGCAGGAGGGAGG - Intergenic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161836295 19:6649353-6649375 GTGAAGAGTGAGGAGGAGGGCGG - Intergenic
1162148807 19:8630709-8630731 CTGGAGAGCCAGGAGGAGCAAGG + Intergenic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1162570140 19:11466790-11466812 ATGGAGTCTCAGGTGGGGGGGGG - Exonic
1162930026 19:13952938-13952960 AGGGAGAATCAGGAGGAAGGGGG + Intronic
1163090291 19:15014711-15014733 CAGGAGACTCAGTGGGGGGGCGG + Intronic
1163159219 19:15454776-15454798 CAGGAGCCGCAGGAAGAGGGAGG + Exonic
1163174774 19:15556538-15556560 CTTCACACTCAGGAGGAAGGAGG - Intergenic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163421180 19:17214554-17214576 CTGGAGTGACAGGATGAGGGTGG - Intergenic
1163520569 19:17789191-17789213 TGGGAGCCCCAGGAGGAGGGTGG + Intergenic
1163640841 19:18461147-18461169 CCGGAGGCGCAGGTGGAGGGCGG + Intronic
1163688507 19:18725662-18725684 TGGGAGGCTCAGGAAGAGGGAGG - Intronic
1164399410 19:27892486-27892508 CTGGACACTGAGGGGCAGGGAGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164944595 19:32282757-32282779 CTGGAGACTCAAAAGGGGAGAGG - Intergenic
1165100071 19:33434049-33434071 CTGGTGACAGAGGAGGAGAGGGG - Intronic
1165247404 19:34505291-34505313 CAGGAAACTCAGGAGGAGTGTGG + Exonic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165463046 19:35955355-35955377 TGGGAGGCTGAGGAGGAGGGTGG + Intergenic
1165595477 19:37008784-37008806 CGGGAGACACAGCAAGAGGGAGG - Intronic
1165789850 19:38484724-38484746 CAGGAGGCTGAGGAGGAGGGAGG + Intronic
1165797714 19:38528470-38528492 CTGGAGAGTCTGGAGAATGGAGG + Intronic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166087332 19:40485695-40485717 CCAGATACTCAGGAGGTGGGAGG + Intronic
1166300018 19:41908003-41908025 CTGGAGCCTGGGGAGGAGGCCGG + Intronic
1166356049 19:42228088-42228110 CTGGAGGCTGAGGCGGAGGCAGG + Exonic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166871902 19:45876441-45876463 CCAGAGACCCAGGTGGAGGGAGG - Intergenic
1167108929 19:47447574-47447596 CTGGGCCCTCAGGAGGAGAGGGG - Intronic
1167408936 19:49333701-49333723 GTGGAGACTCAGCAGGCAGGAGG + Intergenic
1167619236 19:50551914-50551936 AGGGAGGCTGAGGAGGAGGGAGG - Intronic
1167650407 19:50725527-50725549 AGGGAGATTCCGGAGGAGGGTGG - Exonic
1167682429 19:50932245-50932267 CAGGAGGCTGAGGAGCAGGGAGG - Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168393267 19:56027975-56027997 CTGGAGACTGAGGTGGAAGAAGG - Exonic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
925018967 2:553680-553702 CTGTAGTCCCAGGAGGAGGTGGG + Intergenic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925271213 2:2608819-2608841 CTGGGGACCCAGGAGAATGGCGG + Intergenic
925880763 2:8350421-8350443 TTGGGGACTCAGGGGAAGGGTGG + Intergenic
926005873 2:9373185-9373207 CTGGAGCCGGAGCAGGAGGGAGG + Intronic
926489180 2:13502908-13502930 CTGGATGGTCAGGAGGGGGGTGG - Intergenic
926577544 2:14598706-14598728 CTGGAGACTCAGGAGATGGTAGG - Intergenic
926889438 2:17626565-17626587 CTGCAGACACAGGGGCAGGGTGG - Intronic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927139175 2:20118159-20118181 CTGGAAGATCAGGAGGAGGGTGG + Intergenic
927142056 2:20137333-20137355 CCGGGGCCTGAGGAGGAGGGTGG - Intergenic
927927401 2:27023589-27023611 CTGGAGAGTCGGGAGGTGGAGGG - Intronic
928378914 2:30801757-30801779 ATGGAGACTGAGGAAGAGAGTGG + Intronic
928870123 2:35965977-35965999 CTGGAGACCCAGGAAGCTGGTGG - Intergenic
929326464 2:40617576-40617598 TTGGGGGCTCAGGAGGAGGTGGG - Intergenic
929929256 2:46239477-46239499 CTGGGGCTTCAGGAGGAGGGAGG - Intergenic
930068363 2:47345132-47345154 CTGGAGACAAAGGAGAGGGGAGG + Intergenic
930277120 2:49324708-49324730 CTGGGGACTCCAAAGGAGGGAGG + Intergenic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931049150 2:58390547-58390569 CTGGGGATTCAGGAGAAGGTGGG - Intergenic
931217457 2:60260003-60260025 CAGGAGACCCAGGAGGAAGCTGG - Intergenic
932343716 2:70982347-70982369 CTGGCTCCTCAGCAGGAGGGTGG + Intronic
932572062 2:72943351-72943373 GTGGAGACCCCGGGGGAGGGAGG + Exonic
932586913 2:73036241-73036263 CTGCAGACACAGGAGCAGAGGGG - Intronic
932604807 2:73157846-73157868 GTGGAGTCTGAGGAAGAGGGGGG + Intergenic
932808427 2:74803407-74803429 TTGAAGACTTAGGAGGAGAGAGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
935152595 2:100451029-100451051 CTGTACCCTCAGGAGGATGGGGG - Intergenic
935329381 2:101965360-101965382 CTGGAAACTCTGGAGGTGGGTGG + Intergenic
935707592 2:105870255-105870277 CTGGAGGCTGAGGAGGCAGGGGG + Intronic
936316058 2:111425163-111425185 CTGGGGACTCAGGAGCAGCCTGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936500426 2:113062172-113062194 CTGGACACCCAGGATGACGGGGG - Exonic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937355500 2:121195745-121195767 CTGGAGGGTCAGGAGAGGGGAGG + Intergenic
937449779 2:121992610-121992632 CTGGAGGTGCTGGAGGAGGGAGG + Intergenic
937987059 2:127642676-127642698 CTTGAGACTCAGGAGGCGGGTGG - Intronic
938079707 2:128363176-128363198 CAGGGGACTCAGGAAGGGGGTGG + Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939489291 2:142857467-142857489 CTGGAGGCTGAGGAGGAGGATGG + Intergenic
939542195 2:143508033-143508055 ATGGAGATTATGGAGGAGGGGGG - Intronic
939639986 2:144628598-144628620 CTGGTGACCCAGGAAGAGTGAGG - Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
943821802 2:192332731-192332753 CTAGAGGCTCATGAGGATGGAGG + Intergenic
944566643 2:200998183-200998205 CTGGAGAGGAAGGATGAGGGTGG - Intronic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
945437149 2:209832143-209832165 TTGAGGACTCAGGGGGAGGGTGG + Intronic
946113959 2:217445622-217445644 CTGAAGACTGAGGAGGCAGGTGG + Intronic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946419754 2:219558102-219558124 CTGGAGGCTCTGGAGAAGAGAGG + Exonic
946773920 2:223117877-223117899 ATGGAGACACAGGAAGAAGGAGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947383421 2:229567002-229567024 TTGGAGAGTAAGGAGGAAGGTGG - Intronic
947526042 2:230877300-230877322 CAGGGGCCTCTGGAGGAGGGAGG + Intronic
947952987 2:234164118-234164140 CTGGAGCCTCAGGAATAAGGGGG + Intergenic
948299147 2:236888899-236888921 ATTGAGGCTCAGGAGGAGGCAGG - Intergenic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
948686967 2:239675879-239675901 CTGGAGGGGCAGGAGGCGGGGGG - Intergenic
948691220 2:239706337-239706359 GGGGAGACAGAGGAGGAGGGAGG - Intergenic
948731705 2:239968258-239968280 GTGGCCATTCAGGAGGAGGGAGG + Intronic
948789591 2:240370407-240370429 CTGGGGCCTCAGGAGGAGCTGGG - Intergenic
948906643 2:240982830-240982852 CTGGAGACACTGGGGGTGGGAGG - Intronic
948907632 2:240987249-240987271 CTGGAGCCTGAGGAGGGGGAGGG + Intronic
1169064401 20:2686182-2686204 CTGGGGAGGTAGGAGGAGGGTGG - Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169260641 20:4135820-4135842 CTGGTGACTCAGGTAGGGGGAGG - Intronic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169353727 20:4890943-4890965 GTGGGGACTTAGGAGGATGGGGG + Intronic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1170455188 20:16526167-16526189 CTGGGGACTCAGGAAGAGAACGG - Exonic
1170531586 20:17298278-17298300 ATGTAGACTGTGGAGGAGGGTGG - Intronic
1170661526 20:18345844-18345866 CCAGAGACTCAGGAGGAGGAAGG + Intergenic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1171467008 20:25336833-25336855 ATGGAGAGGCAGGAGGAGTGGGG + Intronic
1171959787 20:31485483-31485505 AGGGAGACCCAGGAGGAGGCTGG - Intergenic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173361433 20:42347962-42347984 CTGGAGCCTCAAGAGGACAGAGG + Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173554903 20:43959013-43959035 CTGGAGACCCAGGAGGGCAGTGG - Intronic
1173750090 20:45469813-45469835 CAGCAGGCTGAGGAGGAGGGCGG - Exonic
1174055202 20:47793906-47793928 CTGGAGCCTTTGGAGGAGTGTGG + Intergenic
1174425737 20:50430585-50430607 CTGGTGCCCCAGGAGGTGGGAGG + Intergenic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1175099046 20:56565178-56565200 ATTAAGGCTCAGGAGGAGGGTGG + Intergenic
1175133915 20:56808907-56808929 CTGGAGGCTCAGGAGCAAGCAGG + Intergenic
1175169122 20:57067612-57067634 CTGGAGACCCAGGAGGATCTGGG + Intergenic
1175302195 20:57950956-57950978 CTGGAGGCTCCAGAGGAGGATGG - Intergenic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175343785 20:58254523-58254545 CTGAAGACTCAGAAGGGGAGAGG + Intergenic
1175765358 20:61588662-61588684 CTGGAGACAGAGGAGAAAGGGGG - Intronic
1176283863 20:64331394-64331416 CTGGGGACTTGGGAGAAGGGTGG - Intergenic
1176514536 21:7774235-7774257 AAGGAGCCTCAGGTGGAGGGAGG - Intergenic
1176914433 21:14608242-14608264 CAGGAGATAGAGGAGGAGGGTGG - Intronic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1177832357 21:26153130-26153152 TTAGAGACTCACGAGGAGGAGGG + Intronic
1178648649 21:34404759-34404781 AAGGAGCCTCAGGTGGAGGGAGG - Intronic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179112543 21:38460000-38460022 CTAGAGACTCAGGAAAAGAGAGG + Intronic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179318350 21:40267012-40267034 CGGGAGACTCAGAAGTGGGGAGG + Intronic
1179907742 21:44433019-44433041 CTGAAGACTCAGGTGTGGGGTGG + Intronic
1180151330 21:45949800-45949822 CTCGAGGCTGAGGAGGTGGGAGG + Intergenic
1181041929 22:20196410-20196432 CTGGAGACGCAGGTGCAGGTGGG - Intergenic
1181322927 22:22022619-22022641 CTGCAGCCTGAGGAGGAGGAAGG - Intergenic
1181358687 22:22318549-22318571 CTCCAGACTGAGGAGGAGGAAGG - Intergenic
1181362923 22:22352762-22352784 CTGCAGACTAAGCAGGAGGAAGG - Intergenic
1181365730 22:22375835-22375857 CTGCAGACTGAGCAGGAGGAAGG - Intergenic
1181374771 22:22448295-22448317 CTGGAGACAAAAGAGGATGGGGG + Intergenic
1181435311 22:22906986-22907008 CTGGAGGCTCAGGGGTATGGTGG - Intergenic
1181759688 22:25049571-25049593 CTGGAAACTCAAGAGGAAGAAGG - Intronic
1181851184 22:25751042-25751064 CAGGACACTCAGGCAGAGGGAGG - Intronic
1181871746 22:25904802-25904824 ATAGACACTAAGGAGGAGGGTGG + Intronic
1181972374 22:26701097-26701119 CTAGCTACTCAGGAGGTGGGAGG - Intergenic
1182208144 22:28649196-28649218 TTGGAGACTCAGGAGGTAGGAGG + Intronic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1184450850 22:44582002-44582024 ATGGAGTCTCAGGAGGAGGCTGG - Intergenic
1184477437 22:44729261-44729283 CGGGAGACTCAGGAACAGTGAGG - Intronic
1184644176 22:45887171-45887193 CTGGAGAGTCAGGGAGATGGAGG + Intergenic
1184920736 22:47603929-47603951 GTGAAGACTCAGGAAGAAGGTGG - Intergenic
1184947706 22:47815875-47815897 CAGGAGACTCAGGGGCAGAGAGG + Intergenic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185181380 22:49365459-49365481 CTGGAGGAGCAGGAGGATGGTGG - Intergenic
1185199379 22:49492206-49492228 CTGGGGAGGTAGGAGGAGGGCGG - Intronic
1185282126 22:49977001-49977023 CTGGCTACTCAGGAGGTGGCTGG - Intergenic
1185349136 22:50325440-50325462 CGGGAGACTGAGGAGGAGAATGG - Intronic
1185420442 22:50731656-50731678 TTGGTGACTCGGGGGGAGGGGGG + Intergenic
949518652 3:4829861-4829883 CCTGAGGCTCAGGGGGAGGGAGG - Intronic
949799668 3:7889952-7889974 TTGGGGACTCAGGGGGAAGGTGG + Intergenic
949875596 3:8624259-8624281 GTGGACACTTAGGAGGAGGGTGG - Intronic
950193205 3:10992307-10992329 CTGGTGACCCAGGATGAGGCCGG + Intergenic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950221017 3:11196185-11196207 CTGGAGACTTAGGCAGAGGCTGG - Intronic
950234273 3:11305003-11305025 CTGGTGAGTATGGAGGAGGGGGG - Intronic
951367691 3:21804558-21804580 CTGCACACTCTGGGGGAGGGAGG - Intronic
951491327 3:23272756-23272778 CTGGAGACTCAGGAGAGCTGTGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952661520 3:35855715-35855737 CTGGATACTCAGTAGCAGAGAGG - Intergenic
953028974 3:39163967-39163989 TTGAAGACTCAGAAGTAGGGGGG - Intergenic
953040510 3:39251626-39251648 CTGGAGACTCAAGATGACGGAGG - Intergenic
953103434 3:39852542-39852564 TTGGGGACTCAGGGGGAAGGGGG - Intronic
953383672 3:42492708-42492730 CTGGGGACCCAGGAGGAGAAGGG + Intronic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
953881694 3:46694248-46694270 GTTGAGACTCAGGAGTGGGGAGG - Intergenic
954091498 3:48287912-48287934 CTGGAGAGTGAGGAAGGGGGAGG + Intronic
954760381 3:52869540-52869562 TTGGGGACCCAGGAGAAGGGAGG - Intronic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955138777 3:56248196-56248218 CGGGAGGCTGAGGAGGTGGGAGG - Intronic
955224521 3:57050001-57050023 CCTGAGCCTCAGGAGGAGAGGGG - Intronic
955241938 3:57186064-57186086 CTGGAGACTCTGGAGGAGCAGGG - Intergenic
955457561 3:59140617-59140639 CTGGAGACTCAGGAGTGGGGAGG + Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956056952 3:65309841-65309863 CTGGACAGTGAGGAAGAGGGAGG - Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
957126061 3:76162419-76162441 CCAGTGACTCAGGAGGAGGCGGG - Intronic
958665176 3:97128014-97128036 CCGGAGACTCAGAAGTGGGGAGG - Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960339053 3:116453063-116453085 CTTTAGATTCTGGAGGAGGGAGG + Intronic
960558822 3:119059397-119059419 CTGGGGACTCAGGGGAAGGGTGG + Intronic
961373355 3:126446190-126446212 CTGGAGAATCTGCAGGAGTGGGG + Intronic
961651155 3:128417312-128417334 CTGGAGACCTAGGAGGAGTGGGG - Intergenic
961732507 3:128976619-128976641 CTGGAGACTCAGGAGTCTGAAGG + Intronic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
961817496 3:129558813-129558835 CTGGAGGCTCAGGAGGGGGTTGG - Intronic
961818554 3:129563697-129563719 ATGGAGTCTCAGGAGGAATGGGG + Intronic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962139223 3:132771159-132771181 CTGGGGTCCAAGGAGGAGGGAGG + Intergenic
962342737 3:134598757-134598779 CTGGGGACCCAGGAGGAGTTGGG + Intronic
962673227 3:137730580-137730602 ATGGACACTCAGGAGCAAGGTGG + Intergenic
963063260 3:141241855-141241877 CTGGAGGCTGAGTAGGAGAGGGG + Intronic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965462564 3:168985620-168985642 CTAGAGACTGAGGAGGAAAGGGG + Intergenic
965802952 3:172513222-172513244 CTGGAGACTGAGGAGAGGGCTGG - Intronic
967328039 3:188261806-188261828 CAGGAGGCTGAGGAGGTGGGAGG + Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968094760 3:195921069-195921091 TGGGAGGCTGAGGAGGAGGGTGG - Intergenic
968331965 3:197878524-197878546 CTGGTGACGGAGAAGGAGGGAGG - Intronic
968582233 4:1400484-1400506 CTGGGGACCCAGTAGGAGTGTGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968952799 4:3703328-3703350 CGGGTGGCTCTGGAGGAGGGTGG + Intergenic
969315635 4:6380032-6380054 CAGGAAACCAAGGAGGAGGGAGG - Intronic
969471082 4:7389689-7389711 CTTGAGAATGAGCAGGAGGGAGG + Intronic
969519230 4:7666128-7666150 CAGGAGACTCAGGGGGAGGCAGG + Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970229251 4:13891792-13891814 GGGGAGTCTCAGGAGGAGGTTGG + Intergenic
971456392 4:26849065-26849087 CAGGAGGCTGAGGAGGTGGGAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971765568 4:30826437-30826459 CTGGAGACTCAGTTGGACCGAGG - Intronic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
972845578 4:42984915-42984937 CTGGAGTCTGAGGCTGAGGGAGG + Intronic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
974509548 4:62820709-62820731 CGGGAGTTTCAAGAGGAGGGAGG - Intergenic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
975992834 4:80278380-80278402 CTGGAGACCCAGGAGTAGATGGG - Intronic
976070911 4:81238825-81238847 CTGGAGGCTGAGGAGGGAGGAGG - Intergenic
976582112 4:86749259-86749281 GAGGAGACAGAGGAGGAGGGAGG - Intronic
977082040 4:92542616-92542638 CTGGGGACTCGGTGGGAGGGTGG + Intronic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977507349 4:97918801-97918823 CTGGAAACTCGGGGGAAGGGTGG + Intronic
977564375 4:98566685-98566707 CTGGATGCTGTGGAGGAGGGCGG + Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978827997 4:113047775-113047797 CTGCTGAAACAGGAGGAGGGTGG + Intronic
979000374 4:115209886-115209908 TTGGGGACTCAGGGGAAGGGTGG + Intergenic
980992925 4:139753938-139753960 CTGGAGACTGGGGTGGAGGGAGG + Intronic
980999130 4:139811283-139811305 CTGGAAACACAGGATGATGGAGG - Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
982099353 4:151953180-151953202 CTGGGAACTGAGGAGGAGTGTGG - Intergenic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982765716 4:159346127-159346149 CTGGAAACTAAGGATTAGGGAGG - Intronic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984424316 4:179563789-179563811 CTGAAGCCTCAGGAGGATGGGGG + Intergenic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
984987405 4:185344627-185344649 CTTGAGATTAAGGAGGAAGGAGG + Intronic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985671573 5:1209494-1209516 TTGGAGACTCAGGGAGAGGCTGG - Intronic
985686869 5:1286177-1286199 GTGGAGACTCACGAGGAGGGCGG - Intronic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985787554 5:1906077-1906099 TTGGAGACCCAGGAGGAAAGGGG + Intergenic
985803220 5:2019713-2019735 CTGGAGACTTAGGGAGAGCGTGG + Intergenic
985841970 5:2313314-2313336 CCAGAGGCTCAGGAGGAGGGTGG - Intergenic
985894024 5:2738730-2738752 CCGGAGGCACAGGAGGAGGGAGG - Intergenic
986013838 5:3740563-3740585 CGGGAGAATCTGGGGGAGGGAGG + Intergenic
986065083 5:4227623-4227645 CTGGAGACTCTGGGGGATGGGGG - Intergenic
986325535 5:6670506-6670528 TTGGAGACTAAGGAGGAGATGGG - Intergenic
986351702 5:6886182-6886204 ATGGAGACTCAGGGGGTTGGGGG - Intergenic
986384297 5:7216593-7216615 CTGGAGACTAAGAAGGAAAGAGG - Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986757956 5:10855409-10855431 CTGGGGACTTTGGAGGAGTGTGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987154143 5:15071005-15071027 CAGGAGATTCAGGAGAAGAGAGG + Intergenic
987625555 5:20395428-20395450 CTGGAGACTCAGAAATAGAGAGG + Intronic
988065763 5:26227909-26227931 CTGGAGACCCTGGAGGAGCTGGG - Intergenic
988113599 5:26854874-26854896 TTGGAAACTCAGAAGTAGGGAGG + Intergenic
988434632 5:31159504-31159526 GCGGAGATTCAGGGGGAGGGAGG - Intergenic
988490319 5:31700309-31700331 GTGGAGGCTGAGGAGGAGGTGGG + Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989191939 5:38678869-38678891 CTGGTCACTCAGAAAGAGGGAGG - Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989534024 5:42542788-42542810 CTGGAGACTGAGGAGGGGGTAGG - Intronic
989723583 5:44559568-44559590 TTGGGGACTCAGGGAGAGGGTGG + Intergenic
990037927 5:51345484-51345506 CAGGAGCATAAGGAGGAGGGAGG + Intergenic
990222763 5:53611781-53611803 AAGGAGACTGAGGTGGAGGGAGG - Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
994578348 5:101609548-101609570 ATGGGGACTCAGGGGGTGGGGGG - Intergenic
996304841 5:122035281-122035303 CTGGACACTCAGGAGAAAGATGG - Intronic
996673508 5:126148336-126148358 CAGGAGGATGAGGAGGAGGGGGG - Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997360397 5:133291146-133291168 CAGGAGACACAGGAGGGGAGGGG + Intronic
997417853 5:133742721-133742743 CTGGAGGCTGAGGAGGTGTGAGG + Intergenic
997431647 5:133845012-133845034 GTGGAGACACAGGGGGACGGCGG - Intergenic
998069105 5:139182777-139182799 CTGAGGACACAGGAGCAGGGGGG + Intronic
998135071 5:139670169-139670191 CGGGAGGCTGAGGAGGAGGGAGG - Intronic
998157653 5:139795760-139795782 CTGGAGGAGGAGGAGGAGGGAGG - Intergenic
998161507 5:139815202-139815224 GTGGAGACTGAGGAGGGTGGAGG - Intronic
998352948 5:141512880-141512902 CGTGAGACACAGGAAGAGGGTGG - Exonic
998396185 5:141819849-141819871 CTGGGGCCCCAGGAGGAGAGGGG - Intergenic
999272283 5:150303415-150303437 CTGCAGAACGAGGAGGAGGGAGG - Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999685161 5:154096214-154096236 ATGGTGACTCAGCAGGAGGCAGG - Intronic
999738864 5:154534128-154534150 CTGGAGGCTGAGGAGGAAGATGG - Intergenic
1000061988 5:157666264-157666286 CTGGAGGCTGAGGTGGAGGTGGG - Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001746506 5:174096640-174096662 CTGGAGGCCCAGGAGCAGTGAGG + Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002058583 5:176612726-176612748 CTGGATGCTCAGGTGGAAGGTGG + Intergenic
1002085881 5:176775037-176775059 CAGCAAACTGAGGAGGAGGGAGG - Intergenic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1002761507 6:205988-206010 CAGGTGACTCAGCAGGAGGCTGG - Intergenic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003264924 6:4557204-4557226 CTGCAGACCCAGGAGGAGTTGGG - Intergenic
1004443086 6:15672205-15672227 GTGGAGACTGAGGGGGAGGTGGG + Intergenic
1004797522 6:19104003-19104025 CTAGAGATTCTGGAGGAGGGGGG - Intergenic
1004905003 6:20229332-20229354 ATGGGCTCTCAGGAGGAGGGTGG - Intergenic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005088321 6:22029839-22029861 ATGGAGACTGAGAAGGAGAGAGG + Intergenic
1005715894 6:28548033-28548055 TTGGGGACTCAGGAGGTGTGGGG + Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1007412665 6:41673950-41673972 CTGCAGAGCCAGGAGAAGGGAGG + Intergenic
1007627779 6:43255923-43255945 GTGGAGCCTCAGCAGGAGCGAGG - Intronic
1007694949 6:43726067-43726089 CTGGGGAGTTGGGAGGAGGGCGG - Intergenic
1007712982 6:43836360-43836382 CTGGAGAGTGGGGAGGAGGAAGG + Intergenic
1007719007 6:43874422-43874444 CTGGAAACCCATGATGAGGGCGG - Intergenic
1008365869 6:50678957-50678979 CAGGAGGCTCAGGGGGAGGATGG + Intergenic
1008766650 6:54925214-54925236 CTGGAAATTCAGGAGGAGTTTGG - Intronic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010742287 6:79522793-79522815 CTGGCTACTCAGGAGGTGGGAGG - Intronic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012245753 6:96924390-96924412 CCGGAGAGCGAGGAGGAGGGCGG + Intergenic
1012258286 6:97059123-97059145 GTGGAGACCCAGGATGAGGTAGG + Intronic
1012819847 6:104072476-104072498 CTGGGGACTCGGGGGGAAGGAGG - Intergenic
1012830572 6:104199518-104199540 TTGGAAACTCAGGAGGGGGTAGG + Intergenic
1013318083 6:108960398-108960420 CTGGAGACTGAGTGGGAGGCAGG + Intronic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014096627 6:117468472-117468494 TTGGAGACTCGGGGGAAGGGTGG - Intronic
1015225509 6:130852776-130852798 ATGGAGATGCAGGAGGAAGGAGG - Intronic
1015580816 6:134722752-134722774 CGGGAGAATGTGGAGGAGGGAGG + Intergenic
1015607757 6:134976738-134976760 CTGGAGACTCAGTAGCGGGTAGG + Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015673140 6:135713670-135713692 CTGGAGACTCGGAGGGAGAGTGG - Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016051640 6:139536259-139536281 CTTCAGCCTCAGGATGAGGGCGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1017951106 6:159136158-159136180 TATGAGCCTCAGGAGGAGGGTGG + Intergenic
1018393526 6:163359294-163359316 CTGCGGACACAGGATGAGGGAGG + Intergenic
1018669133 6:166165625-166165647 GTGGAGATTCTGGAGGAGCGGGG - Intronic
1018780043 6:167055007-167055029 CTGGAGACAGGGGAGGAGGAAGG + Intergenic
1018792263 6:167157598-167157620 CTGGAGGCTCAGGTAGAAGGCGG + Exonic
1018958915 6:168432288-168432310 CTGGAGGATGAGCAGGAGGGAGG + Intergenic
1019074137 6:169373450-169373472 CTGGGGACCCAGGGGGAGCGTGG + Intergenic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019312036 7:367586-367608 CTGCAGCCTGGGGAGGAGGGAGG + Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019708651 7:2508353-2508375 CTGGAGACTCCGGAAGGAGGAGG - Intergenic
1019978215 7:4601483-4601505 CTGGAGACTCTGAAGGGTGGGGG + Intergenic
1020079032 7:5276650-5276672 GGGGAGACTGAGGAGGTGGGAGG + Intronic
1020218930 7:6219034-6219056 CTGAGGACTCAGGAGAAGTGAGG + Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021891887 7:25194293-25194315 CTGGAGAGTCAGGAGGGCTGAGG + Intergenic
1022190854 7:28015889-28015911 CTGGAGCCTGGGGAGCAGGGGGG - Intronic
1022266014 7:28755548-28755570 CTGGAGGATTAGGAGTAGGGAGG + Intronic
1022354165 7:29596281-29596303 CTGAAGACTCAGAAGTGGGGAGG + Intergenic
1022657263 7:32330950-32330972 AAGGAGACAGAGGAGGAGGGAGG - Intergenic
1022797304 7:33742393-33742415 CTGGAGAGTAAGGGGGAGGTGGG + Intergenic
1022947086 7:35297265-35297287 CTGGGGACTAAGGAGCAGAGAGG - Intergenic
1023809690 7:43902162-43902184 GTGGAGAGGGAGGAGGAGGGGGG + Intronic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1024996116 7:55274230-55274252 TTGGAGAGTGAGGAGAAGGGAGG - Intergenic
1025108576 7:56193696-56193718 GTGGAGACCCATGGGGAGGGAGG + Intergenic
1025199865 7:56955528-56955550 AGGGAGACTAAGGAGGTGGGAGG - Intergenic
1025672081 7:63621404-63621426 AGGGAGACTAAGGAGGTGGGAGG + Intergenic
1026894914 7:74004344-74004366 CTGGGGAGTGAGGTGGAGGGAGG - Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027140168 7:75651098-75651120 CTGCCCACACAGGAGGAGGGAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027802572 7:82774033-82774055 CTAAAGAATCATGAGGAGGGAGG - Intronic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031779040 7:125939559-125939581 CTGGAGGGTCTGGAGGATGGTGG - Intergenic
1032006378 7:128305240-128305262 CTGGCAACTCAAGTGGAGGGAGG - Exonic
1032458835 7:132094367-132094389 CTGGAGGCTCAAGGGGAGGCTGG - Intergenic
1033130784 7:138743917-138743939 CAGGGGACTCTGGAGGAGAGGGG - Intronic
1033229921 7:139588669-139588691 CTGGAGGCTGAGGACGAGGAGGG + Intronic
1033647037 7:143313091-143313113 GTAGAGGCTCAGAAGGAGGGAGG + Intergenic
1033814677 7:145057437-145057459 CTGGAGGCTCTGGGGGAGGATGG + Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034094051 7:148389971-148389993 CTGGACACTCCTGGGGAGGGGGG - Intronic
1034339773 7:150344754-150344776 CTGGCTACTCAGGAGGCTGGCGG + Intergenic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035187589 7:157138706-157138728 CTGGAGCCTGGGGAGGACGGCGG - Intergenic
1035252853 7:157608451-157608473 CTGCAGGCTGTGGAGGAGGGCGG + Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035727599 8:1834409-1834431 CTGGAGACACAGGCCCAGGGAGG + Intronic
1035752153 8:2003268-2003290 CTTGAGACCCAGGAGGTGTGCGG + Exonic
1036398279 8:8386629-8386651 CTGGAGACTTTGGAGGAGTCGGG - Intergenic
1036553100 8:9832543-9832565 CTGTAGCCTCAGCAGGTGGGAGG - Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036690254 8:10940633-10940655 TGGGAGCCCCAGGAGGAGGGTGG - Intronic
1036799712 8:11781266-11781288 CTGGAAGTTCAGAAGGAGGGTGG + Intronic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037035337 8:14159492-14159514 CTGGAGACTTAAGGGGAAGGTGG + Intronic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038537665 8:28365390-28365412 GTGGAGATTCTGGAGGAGAGAGG - Intronic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1038939953 8:32293416-32293438 CTGGAGCCTCCGGAGGAAGCAGG + Intronic
1039020197 8:33196827-33196849 CTGGAGACTAAGTATGATGGCGG - Intergenic
1039291082 8:36095126-36095148 AGGGGGACTCAGGAGGAGGAAGG + Intergenic
1039304802 8:36249838-36249860 CTGGAGACCCAGGAGGGTTGTGG + Intergenic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040370248 8:46763644-46763666 TTGGAGACTCGGGGGAAGGGTGG + Intergenic
1040458404 8:47622592-47622614 CTGGCGTCCCAGGAGGATGGGGG + Intronic
1041170885 8:55141256-55141278 CTGGAGGCAGAGGAGGAGGGAGG - Intronic
1041216448 8:55606349-55606371 CTGGAGAAGGAGGAGGAGAGAGG - Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1042024983 8:64413770-64413792 CTGTAGACACATGAGGAAGGGGG - Intergenic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042635878 8:70873953-70873975 CTGCTGACTCATCAGGAGGGGGG - Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042981106 8:74529613-74529635 CTGGGGACTCAGGGGGTAGGAGG + Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043534983 8:81192986-81193008 CTGGGGACTCGGGGGGAGGTTGG - Intergenic
1043808272 8:84701636-84701658 CTGGAGGATCAGGAAGAGAGGGG + Intronic
1044143401 8:88683066-88683088 CTGGAGACACTGAAGTAGGGTGG + Intergenic
1044279151 8:90336603-90336625 CTGAGGACTCAAGAGGAGTGTGG - Intergenic
1044381195 8:91535675-91535697 CAGGAAACTTCGGAGGAGGGTGG - Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1044973753 8:97644270-97644292 CAGGAGACCCGGGAGGCGGGAGG - Exonic
1045045337 8:98269839-98269861 CTGGGAACTCTGGAGGAGGGAGG - Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045674058 8:104588923-104588945 GAGGAGACGGAGGAGGAGGGAGG + Exonic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046777957 8:118183832-118183854 CTTGAGATTCAGAAGGCGGGAGG - Intergenic
1046873027 8:119224698-119224720 TTGGAGACTCAGGAGTGGGTGGG - Intronic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047216618 8:122881168-122881190 CTGATGCCTCAGGATGAGGGAGG - Intronic
1047248559 8:123165046-123165068 AAGGAGACCCAGGAGGAAGGCGG + Intergenic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047814464 8:128447758-128447780 CTGGAGAGTAAGAAGGAGAGGGG + Intergenic
1047893787 8:129342995-129343017 ATGGAGACACAGTAGGAAGGAGG + Intergenic
1048254660 8:132896581-132896603 ATGGCCACTTAGGAGGAGGGTGG + Intronic
1048312081 8:133331654-133331676 CTCCAGACTCAGGAGGAGGGTGG - Intergenic
1048435357 8:134411633-134411655 CTTTAGACTGAGGAAGAGGGAGG - Intergenic
1048579490 8:135719370-135719392 ATGGAGGCTGAGGGGGAGGGAGG + Intergenic
1048876171 8:138838257-138838279 CTGGAGGCTCATGGGGAGTGAGG + Intronic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049230889 8:141480573-141480595 CTGGGGACTCAAAAGAAGGGAGG - Intergenic
1049536559 8:143185360-143185382 CAGCAGACGCAGGAGGCGGGAGG - Intergenic
1049691780 8:143964537-143964559 CTGGAGCCTCCGAAGGAGCGTGG + Intronic
1049747665 8:144269851-144269873 CTGGTGAGTGAGGAGCAGGGTGG + Intronic
1049825874 8:144667410-144667432 CTGCAGAGACAGGATGAGGGAGG - Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1052988875 9:34506922-34506944 CTGGAGCCACTGGAGGAGGGAGG + Intronic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053217327 9:36283102-36283124 CTGGGGACCTCGGAGGAGGGAGG - Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053749103 9:41235444-41235466 CTGGAGTCTCAGCGAGAGGGTGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054336761 9:63815305-63815327 CTGGAGTCTCAGCGAGAGGGTGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1055397702 9:75891883-75891905 CTGGAGACTCCGGAGGCGCGGGG + Intronic
1055476705 9:76669833-76669855 CAGAAGACTCGGGAGGAGTGAGG - Intronic
1057008836 9:91583905-91583927 CTGCAGACCCATGAGGATGGAGG - Intronic
1057132096 9:92661383-92661405 CTGGTGACTCAGTAGCAGCGAGG - Intronic
1057397271 9:94691291-94691313 CTGCAGAGGCAGGAGCAGGGTGG - Intergenic
1057847507 9:98536899-98536921 CTGGGGACTGAGGAGCAGGATGG - Intronic
1057885592 9:98827304-98827326 CCGGAGGCTGAGGAGGAGTGAGG - Intronic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058483161 9:105417399-105417421 CTGAAGACCAAGCAGGAGGGAGG - Intronic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1059069393 9:111119829-111119851 CATGAGATTCAGGAGGAGGCAGG - Intergenic
1059405940 9:114098453-114098475 CGGGGCACTCTGGAGGAGGGCGG + Intronic
1059405972 9:114098531-114098553 CGGGGCACTCTGGAGGAGGGCGG + Intronic
1059461330 9:114432320-114432342 CAGGAGCCCCAGGAGGAGAGGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060034112 9:120240368-120240390 CTGAAGAGCCAGCAGGAGGGGGG + Intergenic
1060320815 9:122559198-122559220 CTGAAGATTTAGGAGGAGTGGGG - Intergenic
1061057497 9:128232309-128232331 CTTGAGCCTCAGGAGCAGTGGGG + Intronic
1061213825 9:129208807-129208829 CCAGGGACTCAGGGGGAGGGTGG - Intergenic
1061423518 9:130485012-130485034 CTGGGGGCTCAGGAAGAGGAGGG + Intronic
1061434375 9:130551799-130551821 CTCAAGACTCACGAGAAGGGTGG + Intergenic
1061727718 9:132590482-132590504 ATGGAGACAGAGGAGGAGGAGGG - Intergenic
1061910427 9:133719492-133719514 CTGAAGATTCAAGAGGAGGCAGG - Intronic
1185678002 X:1864467-1864489 CAGGAGGCTGAGGTGGAGGGGGG - Intergenic
1185913671 X:4010375-4010397 CTGGAGACCCAGGAAGCTGGTGG + Intergenic
1185978239 X:4745862-4745884 CTGGGGACTCGGGGGAAGGGTGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186618525 X:11214629-11214651 CTGTGGACTCAGGGAGAGGGTGG - Intronic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187609204 X:20922000-20922022 CTGGGGACTCAGGCATAGGGTGG - Intergenic
1187716030 X:22103459-22103481 TTGGGGACTCAGGGGGAGAGTGG - Intronic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1188666611 X:32830052-32830074 ATGAAGACTCTAGAGGAGGGAGG + Intronic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189288097 X:39866409-39866431 CAGGAGAGGCAGGAGGTGGGAGG + Intergenic
1189379076 X:40488977-40488999 CAGGCGCCTCTGGAGGAGGGTGG - Intergenic
1189464338 X:41267067-41267089 CTTGAGACTGAGGAGAAAGGAGG + Intergenic
1191734532 X:64375244-64375266 CAGGAGACTGAGGAGGTGGGAGG + Intronic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192452170 X:71251433-71251455 AAGGAGAGTTAGGAGGAGGGAGG - Intronic
1192555504 X:72085868-72085890 CTGGAGTTTGAGGAGGAGGGTGG - Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193414410 X:81204042-81204064 CTGAAGACTACAGAGGAGGGAGG - Intronic
1193428581 X:81371629-81371651 CTTGAAGCTCAGGAGGATGGGGG + Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193659373 X:84238338-84238360 CTGGGGACTCAGGGGAAGGATGG + Intergenic
1193787943 X:85783528-85783550 CTGGGGACTACTGAGGAGGGAGG + Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194874478 X:99169671-99169693 CTGGAGACTCAAAAGCAAGGAGG + Intergenic
1195239234 X:102934765-102934787 CCAGGGACTCAGGAAGAGGGAGG - Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195347162 X:103962537-103962559 CTGGAGGCTCAAGCGGAGGAGGG + Intronic
1195360280 X:104076304-104076326 CTGGAGGCTCAAGCGGAGGAGGG - Intergenic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196893537 X:120311581-120311603 GGGGAGACTGAGGGGGAGGGAGG - Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198278909 X:135123332-135123354 GTGGAGCATCAGGAGGAAGGTGG + Intergenic
1198292050 X:135249188-135249210 ATGGAGCATCAGGAGGAAGGTGG - Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199086621 X:143635582-143635604 CTGGAGAGCCTGGGGGAGGGGGG + Intronic
1199849553 X:151715629-151715651 CTGGGGACTCTGGATGGGGGAGG + Intergenic
1199996178 X:153028190-153028212 CTGGAGCCTGAGGAGAGGGGAGG + Intergenic
1200074479 X:153544323-153544345 CTGGAGACTCCAGAGGAGCGTGG - Intronic
1200234965 X:154463781-154463803 CTGGAGAAAGTGGAGGAGGGCGG - Intronic
1200289983 X:154862560-154862582 ATGGACACTCAGGAGGGGAGAGG - Intronic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic