ID: 1064369174

View in Genome Browser
Species Human (GRCh38)
Location 10:14736166-14736188
Sequence CTTAAACTGGACAAGCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064369169_1064369174 4 Left 1064369169 10:14736139-14736161 CCTCCAGAATATATTATGGTAGC No data
Right 1064369174 10:14736166-14736188 CTTAAACTGGACAAGCTGAAAGG No data
1064369170_1064369174 1 Left 1064369170 10:14736142-14736164 CCAGAATATATTATGGTAGCCAG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1064369174 10:14736166-14736188 CTTAAACTGGACAAGCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064369174 Original CRISPR CTTAAACTGGACAAGCTGAA AGG Intronic
No off target data available for this crispr