ID: 1064369761

View in Genome Browser
Species Human (GRCh38)
Location 10:14741135-14741157
Sequence CTCACCTGGTACCCTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064369761_1064369774 28 Left 1064369761 10:14741135-14741157 CCAGAATCAGGGTACCAGGTGAG No data
Right 1064369774 10:14741186-14741208 AAAGAGGAATGAAAAGAGCGAGG No data
1064369761_1064369769 -9 Left 1064369761 10:14741135-14741157 CCAGAATCAGGGTACCAGGTGAG No data
Right 1064369769 10:14741149-14741171 CCAGGTGAGGGTTTGGGGGCAGG No data
1064369761_1064369772 12 Left 1064369761 10:14741135-14741157 CCAGAATCAGGGTACCAGGTGAG No data
Right 1064369772 10:14741170-14741192 GGAACCTGGGCTACAGAAAGAGG No data
1064369761_1064369770 -2 Left 1064369761 10:14741135-14741157 CCAGAATCAGGGTACCAGGTGAG No data
Right 1064369770 10:14741156-14741178 AGGGTTTGGGGGCAGGAACCTGG No data
1064369761_1064369771 -1 Left 1064369761 10:14741135-14741157 CCAGAATCAGGGTACCAGGTGAG No data
Right 1064369771 10:14741157-14741179 GGGTTTGGGGGCAGGAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064369761 Original CRISPR CTCACCTGGTACCCTGATTC TGG (reversed) Intronic