ID: 1064369768

View in Genome Browser
Species Human (GRCh38)
Location 10:14741149-14741171
Sequence CCTGCCCCCAAACCCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 605}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064369768_1064369775 18 Left 1064369768 10:14741149-14741171 CCAGGTGAGGGTTTGGGGGCAGG 0: 1
1: 0
2: 5
3: 64
4: 605
Right 1064369775 10:14741190-14741212 AGGAATGAAAAGAGCGAGGCAGG No data
1064369768_1064369774 14 Left 1064369768 10:14741149-14741171 CCAGGTGAGGGTTTGGGGGCAGG 0: 1
1: 0
2: 5
3: 64
4: 605
Right 1064369774 10:14741186-14741208 AAAGAGGAATGAAAAGAGCGAGG No data
1064369768_1064369772 -2 Left 1064369768 10:14741149-14741171 CCAGGTGAGGGTTTGGGGGCAGG 0: 1
1: 0
2: 5
3: 64
4: 605
Right 1064369772 10:14741170-14741192 GGAACCTGGGCTACAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064369768 Original CRISPR CCTGCCCCCAAACCCTCACC TGG (reversed) Intronic
900075014 1:807320-807342 CATGTCTCCACACCCTCACCTGG - Intergenic
900180504 1:1308997-1309019 CCTCCCCCTTACCCCTCACCGGG - Intronic
900237042 1:1597892-1597914 TCTGGCCCCAAACCCTCTCCTGG - Intergenic
900732251 1:4269798-4269820 CCTCCCCCCAACCCCACAACAGG - Intergenic
900884297 1:5404280-5404302 CCTGCACCCATTCCCTCTCCAGG + Intergenic
900988549 1:6087054-6087076 CCTGCCCCCTGGCCCACACCCGG + Intronic
901412681 1:9095520-9095542 TCTGCCCCCCAGCCCTCAGCAGG + Intergenic
901449835 1:9329219-9329241 CCCACCCACAAACCCTCAACCGG - Intronic
901678738 1:10901381-10901403 CCTGCCCCCTCACCCTCATCTGG - Intergenic
901729535 1:11269232-11269254 CCAGCCCCCCAACCCCCAACAGG + Intergenic
901757393 1:11449590-11449612 CCTGCCCCCAAAGCACCACGGGG + Intergenic
901810793 1:11765946-11765968 CCTGCTGCCACACCCTCCCCAGG + Exonic
901851595 1:12019549-12019571 CCTGCCGCCCAGCACTCACCCGG - Exonic
901936271 1:12629330-12629352 GCTGCCCCCAAACAGTCCCCAGG - Intergenic
902340923 1:15783196-15783218 TCTGCCCCAGAAACCTCACCTGG - Intronic
902543406 1:17170487-17170509 CTTGCCCCCCAACCCCCAACAGG + Intergenic
902606872 1:17573790-17573812 CCTGCCTGCAGATCCTCACCAGG + Intronic
903375271 1:22861901-22861923 CAGGCCCCCAGGCCCTCACCGGG - Intronic
903470423 1:23582995-23583017 TCTGCCCCCCACCCCACACCTGG - Intronic
904461411 1:30682657-30682679 CCTGGTCCCAAGCCCTCAGCAGG - Intergenic
904860472 1:33533821-33533843 CCTGCCTCCCAAACCTGACCTGG - Exonic
905896462 1:41549022-41549044 CCTGCCCCCCACCCCCCAACAGG + Intronic
906061281 1:42950483-42950505 CCTGGCCCCACACCCACACATGG - Intronic
907239869 1:53075454-53075476 ACTGGCCCCCATCCCTCACCTGG + Intronic
907512216 1:54970185-54970207 CCTGCCCCCCAACCCTCACAGGG - Intergenic
907775741 1:57512804-57512826 CATGCCCCCAAACCTAAACCGGG - Intronic
908828462 1:68156120-68156142 CCTGGCCCCCACCCCTCAGCAGG - Intronic
909207736 1:72780994-72781016 TCAGCCCCCAAAACCTGACCAGG + Intergenic
911364161 1:96916409-96916431 CCTGCCCCCAACCCCCCAACAGG - Intergenic
912635795 1:111291504-111291526 CTTGCCCCCAACCCCTCAGCTGG - Intronic
912759048 1:112349905-112349927 CCTGCCCCCCAACCCCCAACAGG + Intergenic
913020400 1:114783847-114783869 CCTGCCCCCCACCCCCCAACAGG + Intergenic
913027859 1:114863965-114863987 CCTGCCCCCCACCCCCCAACAGG - Intronic
913046614 1:115078624-115078646 GCTGTCCACAAGCCCTCACCAGG + Intronic
913230834 1:116739777-116739799 CCTGCCCCCACACCCTCCCGAGG - Intergenic
914440878 1:147705139-147705161 CCTGCCCCCAACCCCACAACAGG + Intergenic
914462466 1:147897697-147897719 CCTGCCTCCTGACCCTCTCCAGG + Intergenic
915238621 1:154503061-154503083 CCTCCCTCCCAACCCTCGCCTGG - Intronic
915275473 1:154785170-154785192 CCTACCCCCAAACATTCAGCAGG - Intronic
915456095 1:156041853-156041875 CCTGCCCCCCTACCCTCACCTGG + Exonic
915543118 1:156581465-156581487 CCAGCATCCAAGCCCTCACCAGG + Exonic
915767907 1:158385517-158385539 CCTGCCCCCCACCCCACAACAGG + Intergenic
915768222 1:158388595-158388617 CCTGCCCCCTACCCCACAACAGG - Intergenic
916088532 1:161289059-161289081 CCACCCCCCCAACCCCCACCAGG - Intergenic
917396721 1:174601489-174601511 CCTGCCCCCAACCCCACGACAGG - Intronic
917702403 1:177594643-177594665 GCTGCCCCCAAGTCCTTACCTGG + Intergenic
917744227 1:177992026-177992048 CCAGCCCCCCAACCCCCAACAGG - Intergenic
917887894 1:179405071-179405093 CTTGCCCCCCAACCCCCAACAGG + Intronic
918215704 1:182391008-182391030 CCTGCGCCCCCACCCTCCCCCGG - Intronic
918467321 1:184834006-184834028 CCTGCCCCCCACCCCACAACAGG + Intronic
919093375 1:192999807-192999829 CTTGCCCCCCAACCCTCTACTGG - Intergenic
919877967 1:201884516-201884538 CATGGCCCCAAATCCTCCCCAGG + Intergenic
920183117 1:204144715-204144737 CCCGCCCCCAAACCCTTCCCAGG + Intronic
920508045 1:206530875-206530897 CCTTCCTCCAGACCTTCACCTGG - Intronic
920679338 1:208060541-208060563 CCTGCCCCAGAAGCCTCCCCAGG - Intronic
921060662 1:211581378-211581400 CCCGCCCCCAACCACCCACCAGG - Intergenic
922270853 1:224032219-224032241 CATGTCTCCACACCCTCACCTGG - Intergenic
922726860 1:227926780-227926802 GCTCCCCCCACACCCTCACATGG + Intronic
923665021 1:235991990-235992012 CCTGACCTCAACCCCTCGCCGGG + Intronic
923676064 1:236081768-236081790 CTTGCCCCAGCACCCTCACCGGG - Intergenic
924160269 1:241224244-241224266 CCAGCCCCCCACCCCTCAACAGG + Intronic
924229195 1:241949239-241949261 CTTGCCCCCAACCCCCCAACAGG + Intergenic
924630178 1:245730303-245730325 CCTCCCCCTAACCCCTCAACAGG - Intergenic
1062874444 10:932515-932537 CCTGCCCCGAAGGCCCCACCGGG + Intergenic
1062874482 10:932597-932619 CCTGCCCCGAACGCCCCACCCGG + Intergenic
1063960040 10:11299450-11299472 GCTGCCCCCCAACCCCCCCCAGG + Intronic
1064150674 10:12861586-12861608 CCTGCCCCCAACCCCACGACAGG - Intergenic
1064369768 10:14741149-14741171 CCTGCCCCCAAACCCTCACCTGG - Intronic
1065554632 10:26902881-26902903 CTTGCCCCACAACCCTCAACAGG - Intergenic
1065960867 10:30732955-30732977 CCTGCCCCCAAACTTACCCCTGG + Intergenic
1066583572 10:36907604-36907626 CCTTCCCCCAACCCCACAACAGG + Intergenic
1067000470 10:42606677-42606699 CTTGCCCCCAACCCCTCAATAGG - Intronic
1067250025 10:44578297-44578319 CATGCTCCCAAACCTTCTCCTGG - Intergenic
1067364151 10:45609586-45609608 CATGCTCCCAAGCCATCACCAGG - Intergenic
1068003311 10:51362776-51362798 CTAGCCCCCAACCCCTCAACAGG + Intronic
1068511158 10:57967516-57967538 CCTGCCTCCCAACCCCCAACAGG - Intergenic
1068986667 10:63113978-63114000 CCTTCCCCAAAACCCTGAACTGG + Intergenic
1069854130 10:71430108-71430130 CCTGCACCCACCCCCTCACTGGG - Intronic
1071001307 10:80833430-80833452 CCTGCCCCCCACCCCTCAACAGG - Intergenic
1071364066 10:84880997-84881019 CCAGCCCCCAACCCCTTAACAGG + Intergenic
1071535008 10:86421247-86421269 CCTGACACCAAACCCTGACGTGG - Intergenic
1072640267 10:97206358-97206380 CCACCCCCAAACCCCTCACCTGG - Intronic
1072784376 10:98269737-98269759 CCTGCTGCCAATCACTCACCAGG + Intergenic
1072795918 10:98354526-98354548 CCTGCACCCCAGCACTCACCAGG - Intergenic
1073047628 10:100649969-100649991 CCTGCCCCCCACCCCTCAGTAGG - Intergenic
1073124590 10:101141481-101141503 CCCACCCCGGAACCCTCACCTGG + Intergenic
1074125574 10:110526225-110526247 CCTTCCCCCAATCCCACCCCTGG + Intergenic
1074889579 10:117724204-117724226 CCTGACCCCACACCCCCAACAGG - Intergenic
1075205232 10:120441573-120441595 CCCGCCCCCAAACCCACAACAGG - Intergenic
1075212435 10:120502607-120502629 CCTGCCCTCACACCCTCACAGGG + Intronic
1075304902 10:121359150-121359172 CCTCTCCCCACACCCTCAACAGG + Intergenic
1075576422 10:123580872-123580894 CCTGCCCCTCCAGCCTCACCTGG + Intergenic
1075756615 10:124817399-124817421 CTTCCCCCCAAACCACCACCAGG + Intronic
1076082547 10:127596586-127596608 CTTGCCCCCAACCCCCCAACAGG + Intergenic
1076708366 10:132315310-132315332 CTTGCCCCCAAACCCCCAGCAGG - Intronic
1077014238 11:392874-392896 GCTGCCTCCTAACCCTGACCCGG + Intronic
1077247385 11:1546329-1546351 CCCGCCACCACGCCCTCACCTGG - Intergenic
1077339919 11:2021683-2021705 CCTGCCGCCACCCCCACACCCGG + Intergenic
1077529622 11:3089103-3089125 TCTGCCCACACAGCCTCACCAGG + Intronic
1078365966 11:10706654-10706676 CCTGCTCTGAAATCCTCACCTGG - Intergenic
1078690549 11:13575750-13575772 CCTGCCCCCCACCCCCCAACAGG - Intergenic
1079454170 11:20622864-20622886 CCTGCCCCCAAAACAGCACGGGG - Intronic
1079686708 11:23367906-23367928 CTTGCCCCCCACCCCTCAACAGG - Intergenic
1080346303 11:31329547-31329569 CCTGCCCCCCACCCCACAACAGG + Intronic
1081281261 11:41211477-41211499 CCTGCCCCCCATCCCACAACAGG + Intronic
1081538614 11:44014090-44014112 CCTGCCCCCAACCCCACTGCTGG - Intergenic
1081862089 11:46339089-46339111 CCTGCCCCCAGCCCCTCTGCAGG - Intronic
1081988855 11:47326870-47326892 CCTGCCCCTAGACCCTCCTCTGG - Intronic
1082718979 11:56649896-56649918 CTTGCCCCCAAACCCCCAATGGG - Intergenic
1082911839 11:58385935-58385957 CCTTCCCCCAACCCCACAACAGG + Intergenic
1082914422 11:58416134-58416156 CCTTCCCCCAACCCCACAACAGG - Intergenic
1083306919 11:61766148-61766170 GCTGCCCCCAAGCCCTTCCCGGG + Exonic
1083417730 11:62536242-62536264 CCCACCCCCAACACCTCACCTGG - Intronic
1084308616 11:68302701-68302723 CATGCCCCCAACCCATCTCCAGG - Intergenic
1084708625 11:70830334-70830356 CCGGACCCCAAACACTCACACGG - Intronic
1084888562 11:72225239-72225261 CCGCCCCAGAAACCCTCACCCGG - Intronic
1085476010 11:76789265-76789287 CCTGTCCCCAGCCCCTCATCTGG - Intronic
1086330572 11:85749852-85749874 CCTGCCCCCAGGAACTCACCAGG - Intronic
1086418329 11:86612062-86612084 CTTGCCCCCCAACCCCCAACAGG + Intronic
1086860425 11:91918836-91918858 CCTCCCCCCAACCCCACAACAGG - Intergenic
1086964262 11:93011380-93011402 CCTGCCCCCCACCCCACAACAGG + Intergenic
1087462609 11:98463769-98463791 CCTGCCCCCCATCCCCCAACAGG - Intergenic
1088405446 11:109470971-109470993 CTTGCCCCCCACCCCTCAACAGG - Intergenic
1088413057 11:109556862-109556884 CCTTCCCCCAAGCCCGCAACAGG - Intergenic
1088648743 11:111938715-111938737 CCTGCCACAGAACCCTCCCCTGG + Intronic
1089201802 11:116729139-116729161 CTCACCTCCAAACCCTCACCAGG + Intergenic
1089347143 11:117797587-117797609 CCGGCCCCCCCACCCTCCCCAGG + Intronic
1090237309 11:125158781-125158803 CCTGCCCACAACCCCTGCCCAGG - Intergenic
1090554819 11:127862924-127862946 CCAGCCCCCAACCCCCCAGCAGG + Intergenic
1090902868 11:131047873-131047895 CCTCGCCCCACACCCTCATCTGG - Intergenic
1090967614 11:131612840-131612862 CCTGTCCCCAAATCCCTACCCGG + Intronic
1091043271 11:132302123-132302145 CCTGCCCCCAAATCCCCACAGGG - Intronic
1202822904 11_KI270721v1_random:76872-76894 CCTGCCGCCACCCCCACACCCGG + Intergenic
1091600535 12:1915306-1915328 CCGGCCCCACAACCCTCAGCAGG - Intronic
1092230630 12:6773727-6773749 CCTGGCCCCCGGCCCTCACCCGG + Exonic
1092241907 12:6840726-6840748 CCTGCCCCCAACCCTCCTCCCGG + Intronic
1092910183 12:13139609-13139631 CCTGCATCCAATCCCTCATCCGG + Intronic
1092910345 12:13140328-13140350 CCTACATCCAATCCCTCACCCGG + Intronic
1093027575 12:14258782-14258804 CCTGCCCCCCAGCTCGCACCAGG - Intergenic
1093645308 12:21579500-21579522 CCTGCCTGCAAAACCACACCTGG + Intronic
1094252508 12:28380167-28380189 CCAGCCCCCCAACCCCCAACAGG - Intronic
1095584466 12:43835707-43835729 GCCGCCCCCCAACCCCCACCAGG + Intergenic
1096312876 12:50536944-50536966 CCTGTCCCCTAATCCTCACTAGG - Intronic
1096328468 12:50687725-50687747 CTTGCCCCCCAGCCCTCAACAGG - Intronic
1096647028 12:53044459-53044481 CCAGCACCCAAACCCTCTACTGG + Intergenic
1096785630 12:54015721-54015743 CCTGCCTGCAACCCCTCCCCCGG + Intronic
1097191772 12:57222793-57222815 GCTGCCCCCGCCCCCTCACCTGG + Intronic
1097804010 12:63945413-63945435 CCAGCCCCCTACCCCTCAACAGG + Intronic
1098136609 12:67409513-67409535 CCAGCCCCCCACCCCTCAACAGG - Intergenic
1100496006 12:95125590-95125612 CCTGCCACCACACTCTAACCTGG + Intronic
1100567362 12:95810164-95810186 CTTGCCCCCAAGCCCCCAACAGG + Intronic
1100955297 12:99901543-99901565 TGTGCCCCCCAACCCTCTCCAGG + Intronic
1101243471 12:102861822-102861844 CCTTCCCCCAACCCCACAACAGG - Intronic
1102800416 12:115727835-115727857 CCTTCCCCCACCCCCTCCCCTGG - Intergenic
1103212094 12:119174677-119174699 CCAGCCCCCAGCCCCTCCCCAGG - Intergenic
1103708634 12:122895174-122895196 CCTGCCTCCAAACCCTGGGCTGG + Intronic
1103915582 12:124374045-124374067 CTAGCCCCCAAACCCACACCCGG + Intronic
1103987510 12:124777802-124777824 GCTGCCCCCACCCCCTCACAGGG - Exonic
1103994009 12:124817515-124817537 CCGGCCCCTCCACCCTCACCTGG + Intronic
1104488582 12:129174226-129174248 CTTGCCCCCCACCCCTCAACAGG + Intronic
1106014982 13:25860443-25860465 CCTGCCCAGAAACCTTCACTTGG - Intronic
1106094434 13:26630307-26630329 CCAGCCCCCCAACCCCCAACAGG + Intronic
1106130887 13:26938578-26938600 CTTGCCCCCAACCCCCCAACTGG + Intergenic
1106959610 13:34983169-34983191 CCTGACCCCCACCCCACACCAGG + Intronic
1107224950 13:38038028-38038050 CCTGCCCCCCACCCCACAACAGG + Intergenic
1107449101 13:40492491-40492513 CCTGCCCCCACAGGCTCACCCGG - Intergenic
1108322589 13:49302627-49302649 CCTGCCCCCAAACCCTCTAGTGG - Intergenic
1108615057 13:52124831-52124853 CATGCCCCCAAACCTTCACTGGG - Intronic
1108702342 13:52954354-52954376 CTTGCCCCCAACCCCCCATCAGG - Intergenic
1109395049 13:61745741-61745763 CCAGCCCCCCAACCCCCAACAGG - Intergenic
1109657512 13:65413109-65413131 CCCGCCCCTAAACCTTCACAAGG + Intergenic
1110715964 13:78704455-78704477 CTTGCCCCCAACCCTTCAACAGG - Intergenic
1111147643 13:84205446-84205468 CTTGCCCCCCAACCCACAACTGG + Intergenic
1111687796 13:91522662-91522684 CCTACCCCCAACCCCACAACAGG + Intronic
1111947608 13:94682023-94682045 ACTGCCCCCAAAGCCTTCCCAGG - Intergenic
1112448941 13:99492103-99492125 CTTGCCCCCAACCCCCCAACAGG - Intergenic
1113409829 13:110075257-110075279 TCAGCCCCCCAACACTCACCAGG + Intergenic
1113547075 13:111161375-111161397 CCTGACCCCAACCCCTTTCCTGG + Intronic
1113681450 13:112247775-112247797 CCACCCCCCCAACCCTCGCCTGG + Intergenic
1113966899 13:114157821-114157843 CCTCCCCCCAACCCCACAACAGG - Intergenic
1114040808 14:18676763-18676785 CCTGCCTCCTACCCCTCTCCAGG + Intergenic
1114045846 14:18875267-18875289 CCTGCCTCCTACCCCTCTCCAGG + Intergenic
1114052219 14:18930078-18930100 CCTGGCCCCAAAACCCCACCTGG - Intergenic
1114110340 14:19471846-19471868 CCTGGCCCCAAAACCCCACCTGG + Intergenic
1114118368 14:19644203-19644225 CCTGCCTCCTACCCCTCTCCAGG - Intergenic
1114341461 14:21749731-21749753 CCTGTACCCAAACCTGCACCTGG + Intergenic
1114369599 14:22071234-22071256 CCTGTACACAAACCCTCATCCGG + Intergenic
1114563944 14:23614456-23614478 TCCACCCCCAAGCCCTCACCAGG - Intergenic
1115671893 14:35622357-35622379 CCAGCCCCCAATCCCCCAACAGG - Intronic
1115955078 14:38768678-38768700 CCTCCCCCCAACCCCACAACAGG - Intergenic
1116538026 14:46060574-46060596 CCTGCCCCCCACCCCACAACAGG - Intergenic
1116898712 14:50341443-50341465 CCCCCCCCCAGACCCTCCCCAGG - Intronic
1117005118 14:51413307-51413329 CCTGCTCCCAAACCCACGGCAGG + Intergenic
1117015640 14:51514339-51514361 CTTGCCCCCTAACCCCCAACAGG - Intronic
1117131808 14:52695123-52695145 CGTGCACCCAACCCCTCTCCTGG + Intronic
1117146161 14:52838622-52838644 CCTGCCCCCCATCCCACAACAGG - Intergenic
1118186621 14:63543481-63543503 CCTGCCGCCAATCCCTGATCAGG - Intergenic
1119703196 14:76768831-76768853 CCTGCCCCCAAGCCTCCACCCGG - Intronic
1120088091 14:80298117-80298139 CCAGCCCCCAAACCCCCGACAGG - Intronic
1121330386 14:93046017-93046039 CCGGGCCTCAAGCCCTCACCAGG + Intronic
1121524409 14:94609321-94609343 CCAGCCCCCAACCCCCCAACAGG - Intronic
1122060920 14:99136201-99136223 CCTGACCCCAAACCCTCTGCAGG - Intergenic
1122068258 14:99188719-99188741 CCTTCTCCCCAACCCTCTCCCGG + Intronic
1122070279 14:99201555-99201577 CCTGCCCCCAGTCCCTGTCCTGG + Intronic
1122270521 14:100566883-100566905 CCTGCCCCCAGGCTCCCACCTGG + Intronic
1122912346 14:104837096-104837118 CCAGCCCCCCAACCCCCAACAGG + Intergenic
1122937009 14:104964374-104964396 GCTGACCCCCAACCCACACCAGG - Intronic
1123108292 14:105853044-105853066 CCTGCTCCCCAACCCACAGCAGG - Intergenic
1124429515 15:29594382-29594404 CATGCCTCCCAACTCTCACCTGG + Intergenic
1124893650 15:33756556-33756578 CCTAGCCCCACACCATCACCTGG + Intronic
1125727689 15:41876529-41876551 CCTGGGCCCAGACCCTCACCTGG + Exonic
1125977496 15:43967915-43967937 CTTGCCCCCAACCCCTCGACAGG + Intronic
1126086446 15:45014858-45014880 CCTGCCCCCCACCCCACAACAGG + Intergenic
1126445003 15:48732540-48732562 CCTCACCCCAAACCCCCAACAGG - Intronic
1127283488 15:57512379-57512401 CATGCCCCCACACCCCCACATGG - Intronic
1129054390 15:72808526-72808548 CCTGCTTCCAAACACTCACATGG - Intergenic
1129823172 15:78618298-78618320 CCTGCCCCCAAACCCTGGGGTGG - Intronic
1130002072 15:80056486-80056508 CATGCTACCACACCCTCACCAGG + Intergenic
1131293587 15:91128408-91128430 CCACCCCGCAAACCCTCACCTGG + Intronic
1131345325 15:91642359-91642381 CCTGCCCCCCACCCCACAACAGG + Intergenic
1132134539 15:99322245-99322267 CCTGCCCCCAGACTCTGCCCTGG - Intronic
1132206050 15:99986975-99986997 CCAGCAGCCAAACCCTAACCAGG - Intronic
1132215568 15:100059208-100059230 GCTGACCCCAAACCCACGCCTGG - Intronic
1132516041 16:366487-366509 CCTCTCCCCCAACCCTTACCTGG - Intergenic
1132631828 16:921463-921485 CCTGCCCCCACACACTCCGCCGG - Intronic
1132711238 16:1268910-1268932 CCTGCCCCCAACCCCAGAGCCGG - Intergenic
1132728387 16:1348670-1348692 CCTGCACCCAACCCCACATCTGG + Exonic
1133026614 16:2991434-2991456 CCTGCCCAGCCACCCTCACCTGG - Intergenic
1133032453 16:3017850-3017872 CCTCCCCCCTCCCCCTCACCTGG - Intronic
1133342076 16:5043223-5043245 CCTCCCCACCAACCCTCACTGGG - Intronic
1134043846 16:11087284-11087306 CCTGCCCACAGAGCCTCACCTGG + Intronic
1134227125 16:12399815-12399837 CCTGCCCACAAGCCCACAGCAGG - Intronic
1134631719 16:15760887-15760909 CCTGACCCTAAACCCCCAACTGG - Intronic
1134865339 16:17601917-17601939 CCTCCCCCCAAACCCTAGCCTGG + Intergenic
1135068382 16:19331003-19331025 CCTGCCCCCAAAGACTCATTTGG - Intergenic
1135415775 16:22267011-22267033 CCTGCCCCCAAACCAGTGCCTGG - Intronic
1135422955 16:22316907-22316929 CCTCTCCCCAGACCCTCACTTGG + Intronic
1135503638 16:23017955-23017977 CCTGCTCCCACCCCCTCCCCAGG + Intergenic
1137686738 16:50391713-50391735 CCGCCCCCCCAACCCTCCCCAGG - Intergenic
1138299588 16:55915143-55915165 CCCACCCCCAAACACACACCAGG + Intronic
1139291975 16:65867595-65867617 CCAGCCCCCACCCCCACACCCGG + Intergenic
1139313737 16:66050018-66050040 CATGCCACCCACCCCTCACCTGG - Intergenic
1139924922 16:70480809-70480831 GCTGCCCCCAGAGCATCACCTGG + Exonic
1140222083 16:73050935-73050957 CCTGCCCCCTAACGCTGAGCTGG + Intronic
1141180600 16:81750814-81750836 CCTGCCACCACACCTGCACCTGG + Intronic
1142156941 16:88536902-88536924 TCTGCCCCCAAGTCCTCCCCAGG + Exonic
1142201424 16:88762797-88762819 CCTGCACACAAGCCCTGACCAGG + Intronic
1142347344 16:89562250-89562272 CCTGGCCCCAAACTTTCCCCTGG - Intronic
1142377042 16:89711715-89711737 CCTGGCCCCGCCCCCTCACCGGG + Intronic
1142943129 17:3399932-3399954 CCTGCCTCCACAGCCTCACCTGG + Intergenic
1143372873 17:6451185-6451207 TCTGCCCCCAATCCCACCCCAGG + Intronic
1143886573 17:10069305-10069327 CCTGCCACTAAATCCTCAACAGG + Intronic
1143989552 17:10944970-10944992 CCTGCCCTCTGACACTCACCAGG + Intergenic
1144017657 17:11211786-11211808 CATTCCCCAAAACCATCACCAGG + Intergenic
1144039482 17:11396735-11396757 CTTGCCCCCCAACCCCCAACAGG - Intronic
1144797915 17:17904936-17904958 CCTGCCCTTGAACGCTCACCTGG - Intronic
1144848120 17:18230579-18230601 CCTGCCCCCACCCCCACCCCAGG - Intronic
1144852176 17:18249307-18249329 ACTGCCCACACACCCTCACCTGG + Exonic
1145101601 17:20081852-20081874 GCTGCCCCCAAAGCCACCCCAGG + Intronic
1145786527 17:27597385-27597407 ACGCCCCCCAACCCCTCACCTGG + Exonic
1146474933 17:33155172-33155194 CCAGCGCCCAACCCCACACCTGG + Intronic
1147213836 17:38887627-38887649 CCCGTCCCCCAGCCCTCACCTGG - Intronic
1147605820 17:41773214-41773236 CCAGCCACCCCACCCTCACCTGG - Intronic
1148232366 17:45944435-45944457 CTCGCCCCCAACCCCTCTCCTGG - Intronic
1148283078 17:46364008-46364030 CCTGCCCCCCAAACCTCTCAGGG + Intergenic
1148305295 17:46581933-46581955 CCTGCCCCCCAAACCTCTCAGGG + Intergenic
1148351656 17:46945806-46945828 GCTGCCCCCAGGACCTCACCAGG + Intronic
1149544657 17:57494418-57494440 CCAGCCCCCAAACCCACTCCAGG - Intronic
1151097348 17:71513734-71513756 CTAGCCCCCAACCCCTCAACAGG + Intergenic
1151319561 17:73344295-73344317 CCTCCCCCCACACCCACAACCGG + Intronic
1151384819 17:73748599-73748621 CCTGCCACTGATCCCTCACCGGG - Intergenic
1151584602 17:75001498-75001520 CCCGCCCCCCAGCCCTCAGCCGG - Intronic
1151646542 17:75436359-75436381 CCTGACCCCATCCCCTCACCTGG + Intergenic
1151763523 17:76120998-76121020 ACAGCCCCCCAACCCTCCCCAGG + Intronic
1151870531 17:76833623-76833645 CATCCCCCCAACCCCTCACAAGG - Intergenic
1152218795 17:79049565-79049587 CCTTCCCCCCATCCCCCACCTGG + Exonic
1152624570 17:81382326-81382348 CCAGCGCCCACATCCTCACCAGG + Intergenic
1152718633 17:81911666-81911688 CCCGCCCCCCGACCCACACCTGG + Intergenic
1153075553 18:1157897-1157919 CCAGCCCCCCACCCCTCAACAGG + Intergenic
1153667834 18:7382193-7382215 ACTCCCCCCAAACACTCACCAGG + Intergenic
1153928169 18:9854126-9854148 CCCACCCCCAACCCCTCAACAGG + Intronic
1154074048 18:11181663-11181685 CTTGCCCCCCAACCCCCAACAGG + Intergenic
1154288032 18:13078782-13078804 CCTGCCCCCCATCCCACAACAGG + Intronic
1155320680 18:24615895-24615917 CTTACCCCCAACCCCTCAACAGG - Intergenic
1155911282 18:31507074-31507096 CCTACCCCCACAGCCTCAACAGG + Intronic
1156474124 18:37394942-37394964 CCCGCCCCCCACCCCCCACCCGG + Intronic
1157332868 18:46716294-46716316 CCTGGCCCCAGACACTCACTTGG + Intronic
1157542772 18:48523865-48523887 CTTGCCCCCCAACCCCCAACAGG - Intergenic
1158036950 18:53043306-53043328 CTTGCCCCCCAACCCCCAGCAGG - Intronic
1158926629 18:62270792-62270814 CCTGCCCCCCACCCCACAACAGG + Intronic
1159165241 18:64690656-64690678 CCTTCCCCCAACCCCACAACAGG - Intergenic
1159695656 18:71553437-71553459 CCTGTCCCCAAAACTTCACTAGG - Intergenic
1160406031 18:78646936-78646958 CCTGCCCCCACACCTCCACTGGG + Intergenic
1160416990 18:78718446-78718468 CCCGCCCCAAAACACACACCAGG - Intergenic
1160915442 19:1494315-1494337 CCTGCCCCCCACCCCGCCCCAGG + Intronic
1161027482 19:2043197-2043219 CCTGCCCCCACCCCCACCCCAGG - Exonic
1161048651 19:2150751-2150773 CCCGCCCCCGGACCCTCCCCGGG - Intronic
1161204573 19:3034331-3034353 CCTTCCCTCAAACCCTCCCCTGG + Intronic
1161288867 19:3482297-3482319 CCTGCCCCCACCCCCTCTGCTGG - Intergenic
1161324558 19:3657225-3657247 TCTGCCCCCACGCCCTCTCCTGG + Intronic
1161494732 19:4580912-4580934 CCTGCCCCGAACCCCCCACCTGG + Intergenic
1161846450 19:6713973-6713995 CCCACCCCCAGTCCCTCACCTGG + Exonic
1161973277 19:7595782-7595804 CCCGCCCCCGAACCCGGACCCGG - Intergenic
1162396002 19:10418453-10418475 CCTGCCCCCATGCCCTCCTCTGG + Intronic
1162955196 19:14093585-14093607 CCTGCTCCCAAACCCTCAGCAGG + Intronic
1163226125 19:15962817-15962839 CCAGCCCCCAACCCCACTCCAGG + Intergenic
1163505639 19:17704409-17704431 CCCGCCCCCCACCCCCCACCCGG - Intergenic
1164403383 19:27919163-27919185 CCTGCCCTCATACCATGACCAGG + Intergenic
1164565984 19:29326436-29326458 CCTACCCCCACTCCCTCCCCAGG - Intergenic
1165137837 19:33681526-33681548 CCTGCCGCCTGTCCCTCACCAGG - Intronic
1165314444 19:35046099-35046121 CCTGCCCCCCAACTCTGCCCAGG - Intronic
1165829442 19:38723266-38723288 CCTGCCCCCTACCCCTCCTCAGG + Intronic
1165831613 19:38733447-38733469 CCTGCCCCAGAACCCCTACCAGG + Intronic
1166303048 19:41922869-41922891 CCTGTCCCCAGCCCCACACCGGG + Intronic
1167169048 19:47818891-47818913 CCTGCCCCCCACCCCACAACAGG + Intronic
1167447040 19:49543684-49543706 ACAGCCCCCAAACCATCTCCAGG - Intronic
1167476801 19:49706101-49706123 CCTGACCCCTGACCCTTACCTGG - Exonic
925182502 2:1826356-1826378 CCCGCCCCCCAGCCCTCCCCAGG - Intronic
925373977 2:3368504-3368526 CCTGCCCCCAGACCTACACATGG + Intronic
926704263 2:15825738-15825760 CCAGCCCCCAGCCCCTCTCCAGG - Intergenic
926890819 2:17637535-17637557 CCAGCCCCCAACCCCACCCCAGG + Intronic
927277967 2:21277888-21277910 ACAGCCGCCAAACCCACACCTGG + Intergenic
927377968 2:22440634-22440656 CTTGCCCCCAACCCCGCAACAGG + Intergenic
927564653 2:24101106-24101128 CCAGCCCCCAACCCCCCAACAGG - Intronic
927727516 2:25438049-25438071 CCTTCCCTCAGACCTTCACCTGG - Intronic
928093565 2:28391026-28391048 CCTGCCCCACACCCCTCTCCTGG + Intergenic
929536403 2:42787029-42787051 CCCGCCACCAAAACCTCAGCAGG + Intronic
929606946 2:43241005-43241027 CCTTCCCCCAAATCCCTACCTGG + Intronic
929957796 2:46472198-46472220 CCTTCCCCCCACCCCTCAACAGG + Intronic
930346528 2:50189359-50189381 CCTACCCCCCAACCCCCAGCAGG - Intronic
931056127 2:58473513-58473535 TCAGCCCCCAGTCCCTCACCAGG + Intergenic
931657677 2:64524678-64524700 CCAGCAGCCAGACCCTCACCCGG + Intronic
932099080 2:68880065-68880087 CCTGCCCCAAAGCCCTCAAGAGG + Intergenic
932492284 2:72130076-72130098 CATGCCCCCTGCCCCTCACCTGG + Exonic
932625426 2:73292682-73292704 CCTGCGCCCACACCCCCTCCCGG - Exonic
932780699 2:74556769-74556791 CCTGGCCCCAGTCCCTCCCCAGG + Exonic
934729756 2:96649176-96649198 CCAGCCTCCAGACCATCACCAGG - Intergenic
934998264 2:98987247-98987269 CCTGCCCCCCACCCCACAACAGG + Intergenic
935095058 2:99936275-99936297 CCTGCCCACATAGCCCCACCAGG - Intronic
937008070 2:118536096-118536118 CCTGCCCCCAACCCATGCCCAGG + Intergenic
937488706 2:122342547-122342569 CCTCACCCCAAACCATCCCCCGG - Intergenic
937533882 2:122862620-122862642 CCACCCCACAAACCCTCTCCTGG + Intergenic
938067979 2:128292197-128292219 CCTCTCCCCACACCTTCACCAGG - Intronic
938069379 2:128300419-128300441 CCTGCCCCCAGCCCTGCACCTGG + Intronic
938472222 2:131575435-131575457 CCTGGCCCCAAAACCCCACCTGG - Intergenic
939849199 2:147283688-147283710 CTTGCCCCCAACCCCGCAACAGG - Intergenic
940439923 2:153702338-153702360 CCTTGCCCCTAACCCTCAGCAGG - Intergenic
940809722 2:158228801-158228823 CCTCCCCCCAACCCCACAACAGG - Intronic
941773983 2:169371921-169371943 CCTGCCCCCCACCACCCACCAGG - Intergenic
942050371 2:172134528-172134550 CCTGCCCCAAGACACCCACCTGG - Intergenic
942251146 2:174048686-174048708 TTTGCCTCCAAATCCTCACCTGG - Intergenic
942538845 2:176994515-176994537 CCAGCCCCCCACCCCTCAACAGG - Intergenic
943078913 2:183233068-183233090 ATTGCCCCCCAACCCTCAACAGG + Intergenic
944879404 2:203996122-203996144 CCTTCCCCCAACCCCACAACAGG - Intergenic
944924111 2:204446007-204446029 CCTGCCCCCAGTCCCCCAACAGG + Intergenic
945777696 2:214127738-214127760 CCTCACCACACACCCTCACCCGG + Intronic
945788285 2:214272443-214272465 CCTGCCCCCCAACCCACAACAGG + Intronic
945948732 2:216018871-216018893 CCTCACCCCTAACCCTCAACAGG + Intronic
946064713 2:216976563-216976585 CCTTGCCCCAAACCCCCAACAGG + Intergenic
946355192 2:219180105-219180127 CCTGACCCCGCACCCTCACTGGG - Exonic
946389803 2:219408589-219408611 CCAGCCCCCAGACCCTCTCCTGG - Intergenic
946712947 2:222525030-222525052 CCTGACCACAAAGCCTTACCAGG - Exonic
947393979 2:229669209-229669231 CTTGCCCCCAACCCCACAACAGG - Intronic
948941994 2:241201376-241201398 GCGGGCCCCAAACCCTGACCTGG + Intronic
948995915 2:241578600-241578622 TCTGCCCCCGAACCATCTCCTGG + Intergenic
949031496 2:241799368-241799390 TCTGTCCCCAAACCCAGACCCGG - Intronic
949082709 2:242117464-242117486 CATGTCTCCACACCCTCACCTGG + Intergenic
1169468119 20:5859271-5859293 CCTGCCCCTCACCCCTCCCCTGG - Intronic
1169821491 20:9715889-9715911 CCCTCCCCCAACCCCTCAACAGG - Intronic
1170962583 20:21038423-21038445 CCAGCCCCCAACCCCTCAACAGG - Intergenic
1172643521 20:36455854-36455876 CCTGTCCCCCAACCCTACCCTGG + Intronic
1172968720 20:38858063-38858085 CTTTCCCCCAAACCACCACCAGG - Intronic
1173157716 20:40629009-40629031 TCTGGCCCCAAACCTTCACTTGG + Intergenic
1173916567 20:46712423-46712445 CCTGCCCCCTGACCCTGTCCCGG + Intronic
1174404022 20:50292319-50292341 CAAGCCCCCAAATCCTAACCTGG - Intergenic
1175020716 20:55845992-55846014 CCTGCCCCCTCATCCTAACCAGG + Intergenic
1175395859 20:58661060-58661082 CAAGCCCCCAAGCCCTCTCCAGG - Intronic
1175810981 20:61857124-61857146 CCTGCCCCCATACCCCTCCCCGG + Intronic
1176222249 20:63975248-63975270 CCTGAGCCCAAGCCCTCCCCTGG - Exonic
1176383034 21:6122881-6122903 CCCGCCCCCAAACCCAGCCCAGG + Exonic
1176407911 21:6431425-6431447 CCTGCCCGCAACCCCACACCTGG - Intergenic
1176426852 21:6553431-6553453 CCTACCCCCATGCCCTCCCCAGG + Intergenic
1179030927 21:37718934-37718956 CCTGCACCCACGGCCTCACCTGG - Intronic
1179060340 21:37973655-37973677 CCTGCCCTCAGACCCAGACCAGG - Intronic
1179060479 21:37974598-37974620 CCTGCCCTCAGACCCAGACCGGG - Intronic
1179315726 21:40242755-40242777 CCTGCCCCCAACCCCACAGTGGG + Intronic
1179560566 21:42213506-42213528 CCTGCCCCCACACCTCCACTGGG - Intronic
1179562118 21:42222091-42222113 CCTTCCCCCACCCCCGCACCGGG - Intronic
1179683402 21:43039756-43039778 CCTGCCCGCAACCCCACACCTGG - Intergenic
1179702343 21:43161753-43161775 CCTACCCCCATGCCCTCCCCAGG + Intronic
1179740435 21:43415358-43415380 CCCGCCCCCAAACCCAGCCCAGG - Exonic
1179992675 21:44956793-44956815 CCTGGTCCCCAGCCCTCACCAGG - Intronic
1180046457 21:45308521-45308543 CCTGGCCACAAACCCGCACTGGG + Intergenic
1180055986 21:45359502-45359524 CCTGTCCCCGAGGCCTCACCCGG - Intergenic
1180065141 21:45408655-45408677 CCTGCCCCCACACAATCAGCGGG - Intronic
1180145161 21:45914694-45914716 CCTGAGCCCAAACCCTGGCCAGG + Intronic
1180147224 21:45928330-45928352 CCTGCCCCCCAGCCCAGACCTGG + Intronic
1180182974 21:46126234-46126256 CCCGCGCCCACACGCTCACCCGG - Exonic
1180192260 21:46171135-46171157 CCTGGCCCCACACCCTCATGAGG + Intronic
1180464377 22:15597884-15597906 CCTGCCTCCTACCCCTCTCCAGG + Intergenic
1180470691 22:15652451-15652473 CCTGGCCCCAAAACCCCACCTGG - Intergenic
1180700420 22:17778471-17778493 GCTGCCCCCAAGCCCTCCCCTGG - Intergenic
1180733506 22:17999651-17999673 CCTCCCCCCAAACCCCCACCTGG - Intronic
1180749246 22:18112988-18113010 ACCTCCCCCAAACCCCCACCAGG - Intronic
1180825170 22:18856655-18856677 CCTGCCACCACCCCCTCCCCAGG + Intronic
1180953998 22:19733340-19733362 CTTGGCCCCAGACCCCCACCTGG + Intergenic
1181027434 22:20134094-20134116 CCTGCACCCAACCCTACACCTGG + Intronic
1181187560 22:21117892-21117914 CCTGCCACCACCCCCTCCCCAGG - Intergenic
1181211638 22:21292601-21292623 CCTGCCACCACCCCCTCCCCAGG + Intergenic
1181397869 22:22634285-22634307 CCTGCCACCACCCCCTCCCCAGG - Intergenic
1181625314 22:24118903-24118925 CCTGCCCCAACTCCCTCTCCAGG - Intronic
1181651538 22:24261773-24261795 CCTGCCACCACCCCCTCCCCAGG + Intergenic
1181705837 22:24648966-24648988 CCTGCCACCACCCCCTCCCCAGG - Intergenic
1181739006 22:24905004-24905026 TCGGTCCCCAATCCCTCACCTGG - Intronic
1182323074 22:29490894-29490916 CCTGCCCCCAGGCCCTCCCCAGG + Exonic
1183311691 22:37113235-37113257 CCTCCCCTCATCCCCTCACCAGG - Intergenic
1184301270 22:43562578-43562600 CCTCCCTCCAACCCCCCACCGGG - Intronic
1184301336 22:43562736-43562758 CCTCCCTCCAACCCCCCACCGGG - Intronic
1184411995 22:44331225-44331247 CCTGCCCCCGGACCCTTCCCCGG + Intergenic
1184419100 22:44369244-44369266 TCTGGCCCCAAGCCCCCACCTGG - Intergenic
1184555638 22:45231528-45231550 CCTGCCACCACCCCCTCCCCAGG + Intronic
1185116062 22:48938963-48938985 CCTGACCCCTAAGTCTCACCAGG - Intergenic
1185127251 22:49018045-49018067 CCTGCCCCGACACCCTCCTCTGG - Intergenic
1185140069 22:49095203-49095225 TCTGCTCCCAAACCCACTCCCGG + Intergenic
1185317736 22:50186129-50186151 CCCGGCCCCAAAACCTGACCCGG - Intronic
1203215315 22_KI270731v1_random:2831-2853 CCTGCCACCACCCCCTCCCCAGG - Intergenic
1203275315 22_KI270734v1_random:82558-82580 CCTGCCACCACCCCCTCCCCAGG + Intergenic
949810880 3:8004773-8004795 CCTGCTCCCAAACCATAACTTGG - Intergenic
950568248 3:13784199-13784221 CTTGCCCCCAGCCCCTCAGCTGG - Intergenic
950698940 3:14726773-14726795 CCTGCCCCCCTACCCCTACCTGG - Intronic
951291205 3:20874064-20874086 CCTCCCCCCAACCCCACAACAGG + Intergenic
951311472 3:21130944-21130966 CCTGTCCCCAACCCCACAACAGG - Intergenic
952048697 3:29357196-29357218 CCAGCCCCCAACCCCACAACAGG + Intronic
952986203 3:38786471-38786493 CTAGCCCCCAACCCCTCAACAGG - Intronic
953406958 3:42664451-42664473 CCTGCCCCCAACCCAGCCCCAGG + Exonic
953492568 3:43363781-43363803 CCTGCGGCCAAACCCCCACTGGG + Intronic
954416979 3:50398052-50398074 CCTGTCCCCAAACCATCAAGAGG - Intronic
954509908 3:51114801-51114823 CTTGCCCCCCAACCCCCAACAGG + Intronic
955068431 3:55552262-55552284 CCTGCCCCCAACCCCACCCCTGG - Intronic
955322239 3:57982646-57982668 CCTGCCATGAAAACCTCACCAGG + Intergenic
956113728 3:65897461-65897483 CCTGCCCCCCACCCCACAGCAGG - Intronic
956407909 3:68948198-68948220 CCTGACCCCAGCCCCTCTCCAGG + Intergenic
956533059 3:70242882-70242904 CCTGCCACCAAACCCCTCCCTGG - Intergenic
957467712 3:80616252-80616274 CTTGCCCCCCAACCCCCAACAGG - Intergenic
957626476 3:82659144-82659166 CTTTCCCCCAAACCCCCAACAGG + Intergenic
957828388 3:85481598-85481620 CTCACCCCCAACCCCTCACCCGG - Intronic
957899856 3:86475099-86475121 CCTGCCCCCCACCCCCCAACAGG - Intergenic
958962391 3:100522670-100522692 CTTGCCCCCTCACCCTCACCTGG + Intronic
960491802 3:118324419-118324441 CCTACCCCCAACCCCTCAACAGG - Intergenic
960592694 3:119380858-119380880 CCTGCTCTCAAGCACTCACCAGG + Intronic
961475115 3:127141252-127141274 CCTGACCTGAAACCCTCACCTGG + Intergenic
961660004 3:128463560-128463582 CCCGCCCCCAGCTCCTCACCAGG + Exonic
961822872 3:129584252-129584274 CCTGCCCCCATGTCCTCCCCTGG - Intronic
961919188 3:130408262-130408284 CCTGCCACCACCCCCACACCGGG - Intronic
963282292 3:143396436-143396458 CCAGCCCCCCAACCCACAACAGG - Intronic
964648526 3:158985744-158985766 CCAGCCCCCAACCCCCCAACAGG + Intronic
965404275 3:168250123-168250145 CCTGCCCCCCATCCCTTCCCGGG - Intergenic
965668310 3:171119790-171119812 CCTCCCCCCAACCCCACAACAGG - Intronic
966479771 3:180393957-180393979 CCTTCCCCCCTACCCCCACCCGG + Intergenic
966516758 3:180828690-180828712 CCGGCCCCCTGACTCTCACCAGG - Intronic
966518422 3:180846070-180846092 CCTGAAGCCAAACCCTCACTGGG - Intronic
966818582 3:183908217-183908239 CCAGCCCTCAAATCATCACCAGG + Intergenic
966874956 3:184316215-184316237 CCTCCCCACAGCCCCTCACCTGG - Exonic
967198752 3:187052445-187052467 CTTGCCCCCAACCCCACAACAGG + Intronic
967274109 3:187757034-187757056 CCTGACCCCAATCCCCCATCAGG + Intergenic
967644940 3:191911495-191911517 CCTTCCCCCAACCCCACAACAGG + Intergenic
968547364 4:1205983-1206005 CCAGGCCCCCAACCCTGACCAGG + Intronic
968761111 4:2443073-2443095 CCTGGGCCCAACCCCTCACCGGG - Intronic
969569345 4:7999583-7999605 CATGCCTGCAAACCCACACCAGG - Intronic
971696278 4:29907859-29907881 CCTGCCCCCACCCCCACAACAGG - Intergenic
972816605 4:42653157-42653179 CCTTCCCCCAGATCCCCACCAGG + Intronic
972828330 4:42786820-42786842 CCTACCCCCAACTCTTCACCAGG - Intergenic
972831935 4:42824131-42824153 CCAGCCCCCCAACCCCCAACAGG - Intergenic
972916806 4:43891677-43891699 CCTGCCCCCCACCCCACAACAGG + Intergenic
973255697 4:48110289-48110311 CCTGAACCCAAACACTCATCTGG - Intronic
973546107 4:51983512-51983534 CCTTCCCCCAACCCCACAACAGG + Intergenic
974255669 4:59451275-59451297 CTAGCCCCCATACCCTCAGCAGG + Intergenic
974840021 4:67288799-67288821 CCCTCCCCCCAACCCCCACCAGG + Intergenic
974854385 4:67441893-67441915 CCTGCCCCCCACCCCCCAACAGG - Intergenic
975235018 4:71984210-71984232 CTTGCCCCCAACCCCTCAATAGG + Intergenic
975508383 4:75165116-75165138 CCAGCCCCCAACCCCCCAACAGG + Intergenic
975756343 4:77575444-77575466 CCAGCCCCCTACCCCTCAACAGG + Intronic
976757115 4:88510417-88510439 CCAGCTCCCAATCCCTCTCCGGG + Intergenic
977690234 4:99898530-99898552 ATTTCCCCCAAACCCTCACAAGG + Exonic
977711722 4:100134286-100134308 CCTGCCCCCCACCCCACAACAGG + Intergenic
978685003 4:111430446-111430468 CTTGCCCCCTACCCCTCAACAGG + Intergenic
978717700 4:111866093-111866115 CCAGCCCCCAACCCCCCAACAGG + Intergenic
980419961 4:132546591-132546613 CCTACCCCCACACCCACACCAGG + Intergenic
980805421 4:137806965-137806987 ACAGCCCCCAAACCACCACCTGG + Intergenic
981288566 4:143047572-143047594 TCTGCCCCCAGAACTTCACCAGG + Intergenic
982231381 4:153211167-153211189 CCTGCCCCCAAAACCACACCTGG - Intronic
982472045 4:155804355-155804377 CTTGCCCCCAAACTCCCAACAGG - Intronic
983769077 4:171525637-171525659 CCTGTCTCCTAACTCTCACCTGG + Intergenic
986672973 5:10159342-10159364 CCTTCCCCCAACCCCTCAACAGG - Intergenic
987180447 5:15362092-15362114 CCAGCCCCCCAACCCCCAACAGG - Intergenic
987752583 5:22060311-22060333 CTTGCCCCCCAACCCCCAACAGG - Intronic
988066543 5:26232944-26232966 CCTGCCCCCCAACAGTCACCTGG + Intergenic
988469844 5:31527640-31527662 CCTGCCACCCACCCCTTACCAGG + Intronic
989078761 5:37593305-37593327 CCTGCTCCCCACCCCTCAACAGG + Intronic
989464800 5:41742630-41742652 CCTGCCCCCCACCCCACAACAGG + Intronic
991400713 5:66248513-66248535 CCTTGCCCCCAACCCTCAACAGG + Intergenic
993035390 5:82750512-82750534 CTTGCCCCCAACCCCCCATCAGG + Intergenic
993552281 5:89288517-89288539 CCTTCCCCCAACCCCACAACAGG + Intergenic
993897183 5:93549958-93549980 CTTGCCCCCAACCCCTCGACAGG - Intergenic
994410076 5:99396256-99396278 CCAGCCCCCCAACCCCCAACAGG - Intergenic
995363328 5:111324997-111325019 CCTTCCCCCAACCCCCCAACAGG + Intronic
996393570 5:122989518-122989540 CCTGCCCCCGCCCCCCCACCCGG - Intronic
996726255 5:126675445-126675467 CCTGCCCATACCCCCTCACCAGG + Intergenic
996977412 5:129451577-129451599 CTTGCCCCCCAACCCACAACTGG - Intergenic
999143282 5:149376914-149376936 CCTGGCCCCTGGCCCTCACCAGG - Exonic
999150839 5:149424851-149424873 CCTGCCCCCAAACCAAGGCCTGG + Intergenic
999270533 5:150294154-150294176 CCTCCACCCAGACCCTCAGCAGG - Intergenic
999808551 5:155106789-155106811 CCTGCAGCCACATCCTCACCTGG - Intergenic
1000144328 5:158438944-158438966 CCAGCCCCCCATCCCTCAACAGG + Intergenic
1000816648 5:165930730-165930752 CCAGCCCCCCAACCCCCAACAGG - Intergenic
1001001818 5:168014780-168014802 CCTGCCCGCAACCCCTGCCCAGG + Intronic
1001035233 5:168292294-168292316 CGTGCCCCCACACCCCCGCCTGG + Intronic
1001664449 5:173421062-173421084 CCAGCCCCCAGCCCCCCACCTGG - Intergenic
1001705207 5:173736611-173736633 CCTGCCCCCACACCCTGCACCGG + Intergenic
1001758989 5:174192257-174192279 CCTCCTCCACAACCCTCACCTGG + Intronic
1002260520 5:177990897-177990919 CCTGCTCCCCGACCCTCAGCAGG - Intergenic
1002425077 5:179170239-179170261 CCTGTCCCCCAGGCCTCACCAGG - Intronic
1002710651 5:181192635-181192657 TCTGCCGCCAGACCCTCACAGGG - Intergenic
1002916121 6:1529179-1529201 CCTGCCCCTAATTTCTCACCAGG - Intergenic
1003624520 6:7728962-7728984 CCTGCCTCCACACCCTCCCTTGG - Intronic
1003906840 6:10708679-10708701 CCTGCCCCCCACCCCACAACAGG + Intronic
1004341991 6:14816092-14816114 CTTTCCCCCAAACCCTCAGAAGG - Intergenic
1006302314 6:33200167-33200189 CCCTCCCCCACACCCTCCCCCGG - Intronic
1006606378 6:35260105-35260127 ACTGACCCCAAGACCTCACCAGG + Intronic
1006671356 6:35731690-35731712 CCTCCACCCCCACCCTCACCCGG + Intergenic
1006938860 6:37738112-37738134 CCACCCTCCAAACCCTAACCAGG - Intergenic
1007171315 6:39865411-39865433 CCTGCCCCCTCATCCTCACAAGG - Intronic
1007258116 6:40542673-40542695 CCTGCTCCCCAACTCTGACCAGG + Intronic
1008250460 6:49232870-49232892 CCATCCCCTAAACCCTCACTTGG - Intergenic
1009794479 6:68450137-68450159 CCAGCCCCCAACCCCCCAACAGG + Intergenic
1010026115 6:71219351-71219373 CTTGCCCCCAACCCCCCAACAGG + Intergenic
1010231497 6:73539252-73539274 CCTGTCCCCACCCCCTCCCCTGG + Intergenic
1010501095 6:76601336-76601358 CCAGCCCCCTACCCCTCAGCAGG - Intergenic
1011105290 6:83773017-83773039 CCTGCCCCCAACTCCCCAACAGG + Intergenic
1011640280 6:89411706-89411728 CCCCACCCCAAACCCTCAACTGG + Intronic
1012243002 6:96895947-96895969 CCTGCCCCCAAAAACTCATCTGG + Intronic
1014653767 6:124073798-124073820 CCTGCTCCCCCACCCCCACCGGG + Intronic
1015435181 6:133178071-133178093 CTAGCCCCCCACCCCTCACCAGG + Intergenic
1015571868 6:134630168-134630190 CTTGCCCCCCACCCCTCAGCAGG + Intergenic
1018828381 6:167423973-167423995 CCTCCCCCCACACACACACCCGG + Intergenic
1018828409 6:167424054-167424076 CCTCCCCCCACACACACACCCGG + Intergenic
1019203062 6:170335205-170335227 CTTGCCCCCAACCCCCCAACAGG + Intronic
1019323740 7:427365-427387 GCGTCTCCCAAACCCTCACCGGG + Intergenic
1019326432 7:440686-440708 CCTTCCCCCAGATCCTCACACGG + Intergenic
1019551254 7:1603743-1603765 CCTGCTCCCCACCCCTCTCCCGG - Intergenic
1019781019 7:2939730-2939752 CCCGCCCCCAGGCCCTCACCTGG + Exonic
1020104876 7:5418074-5418096 CCTGCCCCCACACCCTAGGCTGG - Intronic
1020436146 7:8164441-8164463 CCAGCACTCAACCCCTCACCAGG - Intronic
1020626454 7:10586772-10586794 CCAGCCCCCAAACCCACGACAGG - Intergenic
1020773559 7:12426198-12426220 CCAGCCCCCAATCCCCCAACAGG + Intergenic
1021740811 7:23683411-23683433 CCTGTCTCCAAACCCTGGCCAGG - Intronic
1022141080 7:27493358-27493380 CCTTCCCCCAAATCTTAACCTGG + Intergenic
1022237616 7:28477243-28477265 CCAGCCCCCAAATCCACACTGGG - Intronic
1022318181 7:29264026-29264048 GCTGCCCCCCACCCCCCACCCGG - Intronic
1022973898 7:35539738-35539760 CCTGCCCCAACCCCCTCACAGGG - Intergenic
1023065636 7:36374686-36374708 CCTGCCCCCAACTCCACAACAGG + Intronic
1024452203 7:49560241-49560263 CCTCCCCCCCAACCCACAACAGG - Intergenic
1024518249 7:50279874-50279896 CCTGCCCCCTAACCCCCAATCGG - Intergenic
1025732384 7:64118087-64118109 CATGCCCTCAAGCCCTCAACAGG - Intronic
1026099617 7:67373820-67373842 CCTGCCCCCCACCCCACAACAGG + Intergenic
1026359958 7:69594505-69594527 CTTGCCCCCCACCCCTCAACAGG + Intergenic
1026910666 7:74089990-74090012 CCTGTCCCAAATCACTCACCAGG + Intronic
1027353427 7:77334416-77334438 CCTTCCCCCAACCCCCCAACAGG - Intronic
1028276400 7:88863222-88863244 CCTGCCCCCGAACCCTACCTCGG + Intronic
1028499008 7:91497273-91497295 CTTGCCCCCAACCCCACAACAGG + Intergenic
1029053314 7:97712566-97712588 CCAGCCCCCAATCCCCCAACAGG - Intergenic
1029880335 7:103801573-103801595 CCTGCCCCCCACCCCACAACAGG - Intronic
1029990647 7:104959869-104959891 CCTGCCCCCTACCCCCCAACAGG - Intergenic
1030926801 7:115467008-115467030 CTAGCCCCCAAACCCCCAACAGG - Intergenic
1031384111 7:121125458-121125480 CTTGCCCCCCAACCCCCAACAGG + Intronic
1031441703 7:121802494-121802516 CCTGCCTCCAAAAGCTTACCTGG + Intergenic
1032455962 7:132073823-132073845 CCTGCCCCCCAGGCCACACCCGG + Intergenic
1033732702 7:144195238-144195260 CCTGCCCCCAGACGTTCCCCGGG - Intronic
1033743553 7:144293818-144293840 CCTGCCCCCAGACGTTCCCCGGG - Intergenic
1033750349 7:144355779-144355801 CCTGCCCCCAGACGTTCCCCGGG + Intronic
1034268253 7:149791453-149791475 CCTGACCCCACTCCCTCCCCAGG + Intergenic
1034569827 7:151946491-151946513 CCTTCCCCCAACCCCACAACAGG + Intergenic
1035540632 8:434167-434189 CATGTCTCCATACCCTCACCTGG + Intronic
1035553152 8:545044-545066 CCCGCCCCCAAACCTTCCCCAGG + Intronic
1035611444 8:968255-968277 CCTGCCCCCAACCCCCCAGCTGG + Intergenic
1035921097 8:3676996-3677018 CTTGCCCCCAACCCCGCAACAGG - Intronic
1037259311 8:16989523-16989545 CCTGCCCCCCATCCCCCAACAGG - Intergenic
1037376768 8:18238623-18238645 TCTGCCCCCAAAGCCTCACAAGG + Intergenic
1037994013 8:23339861-23339883 CCAGCCCCCAGCCCCTCACATGG - Intronic
1038358669 8:26855572-26855594 CTTGCCCCCCAACCCCCAACAGG - Intronic
1038589821 8:28826495-28826517 CCTGCCACAAAACCCTGAACCGG - Intronic
1038855218 8:31323802-31323824 CCTGCCCCCAACCCCACGGCAGG + Intergenic
1039959590 8:42235940-42235962 TCCGCCCCCCAACCCCCACCCGG - Intergenic
1042566492 8:70117202-70117224 CCTACCCCTAAACCCCCAGCCGG + Intronic
1042671009 8:71263286-71263308 CCTGCCTCCACCCCCTCCCCTGG + Intronic
1042980809 8:74525573-74525595 CCTGCCCCCAACCCCACAACAGG - Intergenic
1042993063 8:74662428-74662450 CTTGCCCCCCACCCCTCAGCAGG - Intronic
1044037865 8:87328134-87328156 CGTGCCCCCAATCCCCCAACAGG + Intronic
1045155000 8:99458065-99458087 CCTCCCCCCAACCCCACAACAGG + Intronic
1045472059 8:102521304-102521326 CATTCCCCCAAACCCTGCCCTGG + Intergenic
1045590266 8:103585721-103585743 CTTGCCCCCAACCCCCCAACAGG - Intronic
1045639942 8:104238291-104238313 CTTGCCCCCTACCCCTCAACAGG - Intronic
1045742739 8:105381074-105381096 CTTGCCCCCCACCCCTCAACAGG + Intronic
1046395948 8:113639719-113639741 CCAGCCCCCAACCCCACAACAGG + Intergenic
1047967951 8:130060785-130060807 CCTGCCCCCCAAACCACAGCTGG - Exonic
1048064128 8:130950427-130950449 CCAGCCCCCAAACCCTGACACGG - Intronic
1048695795 8:137026385-137026407 CCTCCCCCCAACCCCACAACAGG - Intergenic
1049435915 8:142586176-142586198 CCTGCCCCGCAACCTGCACCCGG - Intergenic
1049674712 8:143884318-143884340 CATGCCCCCACAGCCTCACCTGG + Intergenic
1049682782 8:143927135-143927157 CCAGCCCCTAAACCCTCACATGG + Intronic
1050217957 9:3349576-3349598 ACTGCCCCCACACCCCCAACAGG + Intronic
1050631307 9:7561580-7561602 CCTGCCCCCTACCCCACTCCAGG + Intergenic
1051021020 9:12542874-12542896 CCAGCCCCCAACCCCCCAACGGG + Intergenic
1051679522 9:19593286-19593308 TCTGCCCCCAATCCAGCACCTGG + Intronic
1053123498 9:35562345-35562367 CCAGTCCCCAAAGCCTCCCCGGG + Intronic
1053307556 9:36995131-36995153 CCTGCCCCCAAAGCCACACTGGG + Intronic
1054870282 9:70042973-70042995 CCTGCTCCCATGCCTTCACCTGG - Intergenic
1055774615 9:79753905-79753927 CCTCACCCCATACCCACACCTGG - Intergenic
1056015796 9:82386326-82386348 CCTACCCCCAACCCCACAACAGG + Intergenic
1056190317 9:84178290-84178312 CCAGCCCCCCACCCCTCAACAGG + Intergenic
1056190958 9:84183306-84183328 CCAGCCCCCCACCCCTCAACAGG - Intergenic
1056265041 9:84888680-84888702 CCTGCCCTCAAAGCCACCCCAGG + Intronic
1056275957 9:84994471-84994493 CCTGCCTCCAAACCATCCTCTGG - Intronic
1056319328 9:85421548-85421570 CCAGCCACCAATCCCTCAGCAGG + Intergenic
1057360443 9:94368818-94368840 CCTGCCCCCCAACTCACAACAGG + Intergenic
1057363213 9:94394489-94394511 CCTGCCACCACACGCTAACCTGG - Intronic
1057660123 9:96993610-96993632 CCTGCCACCACACGCTAACCTGG + Intronic
1057662899 9:97019260-97019282 CCTGCCCCCCAACCCACAACAGG - Intergenic
1057895950 9:98908715-98908737 CCTGTCCCAAAACCCTAATCTGG - Intergenic
1058391557 9:104501187-104501209 CTTGCCCCCGACCCCTCAACAGG + Intergenic
1058793757 9:108476872-108476894 CCAAGCCCCAAAGCCTCACCAGG + Intergenic
1058988261 9:110229567-110229589 CCCTCCCCCAAACCCACAACAGG + Intergenic
1059500590 9:114750089-114750111 CTTGCCCCCCACCCCTCAACAGG + Intergenic
1059742361 9:117164550-117164572 CCTGCCCCCCAATCCCCTCCAGG + Intronic
1060745396 9:126127690-126127712 CCTGCCTCCAAAAGCTCCCCTGG + Intergenic
1061481970 9:130901872-130901894 CCTGCCCCCGGCCCCTCGCCAGG + Intergenic
1062232601 9:135490440-135490462 CCTGCCCCCATGCCCACCCCAGG + Intergenic
1062460421 9:136660455-136660477 CCTGCCCCCAGCCCCTCCCCAGG - Intronic
1062482614 9:136759450-136759472 CCTGCCCCCTGCCCCTCCCCAGG + Intergenic
1062732320 9:138117176-138117198 CCTGCCCCAACAGCCCCACCCGG - Intronic
1185695455 X:2190892-2190914 CTTGCCCCCCAACCCCCAGCAGG - Intergenic
1185936632 X:4263873-4263895 CCTGCCCGCGATCCCTCCCCAGG - Intergenic
1187376922 X:18763914-18763936 CCTGCCAGCAAACCTTCGCCTGG - Intronic
1189243941 X:39548405-39548427 CCAGCCCCCCAACCCCCAACAGG - Intergenic
1189533521 X:41912029-41912051 CTTGCCCCCCAACCCCCAACAGG + Intronic
1189951226 X:46233346-46233368 CCTGCCCCCACACCCTTCCCAGG - Intergenic
1191807492 X:65150486-65150508 CCTGCCCCCGACCCCCCAACAGG + Intergenic
1192977057 X:76297998-76298020 CCCTCCCCCAAACCCACAACAGG + Intergenic
1193057431 X:77168497-77168519 CCTACCCCCAAACACCCACAGGG - Intergenic
1193110780 X:77727672-77727694 CTTGCCCCCAACCCCCCAACAGG - Intronic
1193192009 X:78581890-78581912 CTTGCCCCCCAACCCCCAACGGG - Intergenic
1193728778 X:85077255-85077277 CCTGCCCCCCACCCCACAACAGG + Intronic
1194532725 X:95070981-95071003 CTTTCCCCCAAACCCTCGACAGG - Intergenic
1194575805 X:95613101-95613123 CTTTCCCCCAACCCCTCAACAGG + Intergenic
1194650454 X:96508292-96508314 CCTGCCCCCAAACCCATGACAGG + Intergenic
1194661573 X:96633840-96633862 CTTGCCCCCCAACCCCCAACAGG - Intergenic
1195013066 X:100752310-100752332 CCTGCCCCCCACCCCCCAACAGG + Intergenic
1195405296 X:104506122-104506144 CCTCCCCCCAACCCCACAACAGG + Intergenic
1195405845 X:104512413-104512435 CCTGCCCCCGACCCTTCACCAGG + Intergenic
1195947993 X:110235806-110235828 CCAGCCCCCAACCCCACAACAGG - Intronic
1196992712 X:121346641-121346663 CCGGCCCTCAAACCCACAACAGG - Intergenic
1197185332 X:123579793-123579815 CTTGCCCCCCAACCCTCAACAGG - Intergenic
1197506543 X:127311726-127311748 CTTGCCCCCCAACCCCCAGCAGG - Intergenic
1198886469 X:141343881-141343903 CTTGCCCCCAAGCCCGCAACAGG + Intergenic
1198986790 X:142463897-142463919 CTTGCCCCCAACCCCCCAACAGG + Intergenic
1199066270 X:143422368-143422390 CTTGCCCCCACCCCCTCAACAGG + Intergenic
1199609159 X:149598887-149598909 TCTGCCCCCTACCCCGCACCCGG - Intronic
1199629959 X:149770468-149770490 TCTGCCCCCTACCCCGCACCCGG + Intergenic
1200269162 X:154665280-154665302 CCAGCCCCCCAACCCACAACAGG + Intergenic
1200337340 X:155364138-155364160 CCTAACCCCTAACCCTAACCAGG + Intergenic
1200349130 X:155477089-155477111 CCTAACCCCTAACCCTAACCAGG - Intergenic
1201018023 Y:9624626-9624648 GCTTCTCCCAAACCCTCTCCCGG - Intergenic
1201387886 Y:13463014-13463036 CCTCCCCCCAACCCCACAACAGG + Intronic
1201699091 Y:16860135-16860157 CCTGCCCCCCACCCCACAACAGG - Intergenic
1202058835 Y:20864786-20864808 CCTGCCCCCAACCCCACATGAGG + Intergenic