ID: 1064369769 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:14741149-14741171 |
| Sequence | CCAGGTGAGGGTTTGGGGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064369761_1064369769 | -9 | Left | 1064369761 | 10:14741135-14741157 | CCAGAATCAGGGTACCAGGTGAG | No data | ||
| Right | 1064369769 | 10:14741149-14741171 | CCAGGTGAGGGTTTGGGGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064369769 | Original CRISPR | CCAGGTGAGGGTTTGGGGGC AGG | Intronic | ||