ID: 1064369769

View in Genome Browser
Species Human (GRCh38)
Location 10:14741149-14741171
Sequence CCAGGTGAGGGTTTGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064369761_1064369769 -9 Left 1064369761 10:14741135-14741157 CCAGAATCAGGGTACCAGGTGAG No data
Right 1064369769 10:14741149-14741171 CCAGGTGAGGGTTTGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064369769 Original CRISPR CCAGGTGAGGGTTTGGGGGC AGG Intronic
No off target data available for this crispr