ID: 1064369774

View in Genome Browser
Species Human (GRCh38)
Location 10:14741186-14741208
Sequence AAAGAGGAATGAAAAGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064369768_1064369774 14 Left 1064369768 10:14741149-14741171 CCAGGTGAGGGTTTGGGGGCAGG 0: 1
1: 0
2: 5
3: 64
4: 605
Right 1064369774 10:14741186-14741208 AAAGAGGAATGAAAAGAGCGAGG No data
1064369761_1064369774 28 Left 1064369761 10:14741135-14741157 CCAGAATCAGGGTACCAGGTGAG No data
Right 1064369774 10:14741186-14741208 AAAGAGGAATGAAAAGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064369774 Original CRISPR AAAGAGGAATGAAAAGAGCG AGG Intronic
No off target data available for this crispr