ID: 1064376232

View in Genome Browser
Species Human (GRCh38)
Location 10:14798933-14798955
Sequence TTTAAATACCCCCATGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064376232_1064376235 10 Left 1064376232 10:14798933-14798955 CCACTTACATGGGGGTATTTAAA No data
Right 1064376235 10:14798966-14798988 AGAAGCAGAGGGTAGAAAAGTGG No data
1064376232_1064376234 -1 Left 1064376232 10:14798933-14798955 CCACTTACATGGGGGTATTTAAA No data
Right 1064376234 10:14798955-14798977 AAGATTATCACAGAAGCAGAGGG No data
1064376232_1064376238 25 Left 1064376232 10:14798933-14798955 CCACTTACATGGGGGTATTTAAA No data
Right 1064376238 10:14798981-14799003 AAAAGTGGTTGCTGGAGACTGGG No data
1064376232_1064376236 17 Left 1064376232 10:14798933-14798955 CCACTTACATGGGGGTATTTAAA No data
Right 1064376236 10:14798973-14798995 GAGGGTAGAAAAGTGGTTGCTGG No data
1064376232_1064376233 -2 Left 1064376232 10:14798933-14798955 CCACTTACATGGGGGTATTTAAA No data
Right 1064376233 10:14798954-14798976 AAAGATTATCACAGAAGCAGAGG No data
1064376232_1064376237 24 Left 1064376232 10:14798933-14798955 CCACTTACATGGGGGTATTTAAA No data
Right 1064376237 10:14798980-14799002 GAAAAGTGGTTGCTGGAGACTGG No data
1064376232_1064376239 26 Left 1064376232 10:14798933-14798955 CCACTTACATGGGGGTATTTAAA No data
Right 1064376239 10:14798982-14799004 AAAGTGGTTGCTGGAGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064376232 Original CRISPR TTTAAATACCCCCATGTAAG TGG (reversed) Intergenic
No off target data available for this crispr