ID: 1064376236

View in Genome Browser
Species Human (GRCh38)
Location 10:14798973-14798995
Sequence GAGGGTAGAAAAGTGGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064376232_1064376236 17 Left 1064376232 10:14798933-14798955 CCACTTACATGGGGGTATTTAAA No data
Right 1064376236 10:14798973-14798995 GAGGGTAGAAAAGTGGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064376236 Original CRISPR GAGGGTAGAAAAGTGGTTGC TGG Intergenic
No off target data available for this crispr