ID: 1064379134

View in Genome Browser
Species Human (GRCh38)
Location 10:14824722-14824744
Sequence TTCTGCCAGCTTTAAATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064379134_1064379137 -6 Left 1064379134 10:14824722-14824744 CCCAAAATTTAAAGCTGGCAGAA 0: 1
1: 0
2: 1
3: 33
4: 336
Right 1064379137 10:14824739-14824761 GCAGAATGGTAGCTCTGCCTAGG No data
1064379134_1064379138 -2 Left 1064379134 10:14824722-14824744 CCCAAAATTTAAAGCTGGCAGAA 0: 1
1: 0
2: 1
3: 33
4: 336
Right 1064379138 10:14824743-14824765 AATGGTAGCTCTGCCTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064379134 Original CRISPR TTCTGCCAGCTTTAAATTTT GGG (reversed) Intronic
902141247 1:14357899-14357921 CTCTGCCAGGTTTCAATATTGGG + Intergenic
902173602 1:14632706-14632728 TTCTGCCAGGTTTACACTTGCGG - Intronic
902901737 1:19521792-19521814 TTCAGCTAGATTTATATTTTTGG - Intergenic
903563554 1:24247172-24247194 GTGTGCCTGCTTTTAATTTTTGG - Intergenic
904709431 1:32417604-32417626 ATCTGACAGTTTTGAATTTTGGG + Intergenic
907056999 1:51378825-51378847 TTCTTCCAGCTCTAAGTTTGAGG + Intronic
907304507 1:53506273-53506295 CCCTGCCAGTTTTATATTTTTGG - Exonic
907595474 1:55715641-55715663 TTCTGAGAGCTTTAGATTTTAGG + Intergenic
907681991 1:56572941-56572963 TTTTGCCAGCATGTAATTTTGGG - Intronic
907899500 1:58724884-58724906 TTCTGCTAGAATAAAATTTTTGG - Intergenic
908741075 1:67328210-67328232 TTCTGCCAGGTTAAATTTTTTGG - Exonic
909146999 1:71947634-71947656 TTCTGCAAGTTTTAAACTTTGGG + Intronic
909667983 1:78157510-78157532 TTCTACCACCTTCAAATATTTGG - Intergenic
910408068 1:86911549-86911571 TCATGACAGATTTAAATTTTAGG + Intronic
910418519 1:87028678-87028700 TTTTGCAAACTCTAAATTTTGGG + Intronic
910721820 1:90295043-90295065 TTCTGCCTGCCCTAATTTTTAGG - Intergenic
910868706 1:91811721-91811743 TTATCCCAGTTTTAAATTTTTGG - Intronic
911385778 1:97173748-97173770 TTCTGACAGATTTTGATTTTTGG - Intronic
911895721 1:103432576-103432598 TTCTATCAGGTTTAAATATTTGG - Intergenic
912194995 1:107387306-107387328 TTCTACCAGAATAAAATTTTTGG - Intronic
912595064 1:110867230-110867252 TTCTGCCAGGTTTCAGTATTAGG - Intergenic
913653397 1:120939386-120939408 TTCTGCCTGCTTTATATTCATGG + Intergenic
914167705 1:145189647-145189669 TTCTGCCTGCTTTATATTCATGG - Intergenic
914519086 1:148399510-148399532 TTCTGCCTGCTTTATATTCATGG + Intergenic
914643580 1:149633549-149633571 TTCTGCCTGCTTTATATTCATGG + Intergenic
916218091 1:162415788-162415810 TTCCCCCAGCACTAAATTTTTGG - Intergenic
916336934 1:163683156-163683178 TTCTGGGAGTTTTACATTTTTGG - Intergenic
917105829 1:171490891-171490913 TTGTGCCAGCTGTTAATTTTGGG + Intronic
917833907 1:178924726-178924748 TTCCCTCAGCTTTAATTTTTTGG - Intergenic
919392592 1:197006100-197006122 TTCTGCGAATTTTAAATTATTGG - Intronic
922975108 1:229777873-229777895 TTCTGCCACCTCTAAATATCAGG - Intergenic
923121562 1:230997233-230997255 TTATGCCATCTTTAAATCTCAGG + Exonic
923795168 1:237146967-237146989 TTATACCAGCTTTAAAGTTTGGG + Intronic
924198142 1:241631459-241631481 TTCTGTTAGATTTAAACTTTAGG + Exonic
924323436 1:242872021-242872043 TTCTTTCAGATTTAAGTTTTTGG - Intergenic
924378898 1:243442814-243442836 TTCTTCCTGATTTAAATGTTTGG + Intronic
1063907277 10:10794203-10794225 ATCTGCCAACCTTAAAATTTTGG + Intergenic
1064039622 10:11948764-11948786 TTCTTACAGCTTTAAATACTTGG + Intronic
1064379134 10:14824722-14824744 TTCTGCCAGCTTTAAATTTTGGG - Intronic
1065007414 10:21392768-21392790 TTCTGCCAGCTCCAAGTTTTAGG + Intergenic
1065580921 10:27171229-27171251 TTCTACCAGCTTTACTTTTCTGG - Intronic
1066314288 10:34228393-34228415 TTCTTCCAGCTTTTATGTTTTGG - Intronic
1067288117 10:44922143-44922165 TTCTGCCAGGTTTCAGATTTAGG - Intronic
1067362604 10:45596042-45596064 TTCTGACCACTTTGAATTTTTGG + Intergenic
1068038583 10:51792830-51792852 TTCTACAAGCTCTAATTTTTAGG - Intronic
1070183768 10:74039857-74039879 TTAGGCCAGCTTGAAATATTTGG - Intronic
1070363707 10:75715626-75715648 TTTTGCCAGTCTTAAATTTTTGG + Intronic
1070956474 10:80466973-80466995 TTCTGCTGACTCTAAATTTTTGG - Intronic
1072009535 10:91291239-91291261 TTCTGAGAGCTTTAAATATCAGG - Intergenic
1075194351 10:120342051-120342073 CTCTGCCAGCCTTAGCTTTTTGG - Intergenic
1075872181 10:125779009-125779031 TTCTGCCTGCTTTGTATTCTAGG + Intergenic
1076644131 10:131940284-131940306 TTATTCCTGCTTTAAATTTTGGG + Intronic
1077025430 11:437910-437932 TCCTGCCGGCTTTCAACTTTCGG - Intronic
1078058594 11:8029336-8029358 TTCTTCCACTTTTAAAGTTTGGG + Intronic
1079276898 11:19048023-19048045 TTCTCTCATCTTTAATTTTTTGG - Intergenic
1080967310 11:37228083-37228105 TTCTGCCAGCTTCAGAGTGTTGG + Intergenic
1081544683 11:44062301-44062323 TTCTTCAACCTTTAAATATTTGG + Intergenic
1082300423 11:50498234-50498256 TTCTTCCAGCTTTATTCTTTTGG - Intergenic
1082709526 11:56537365-56537387 TTCTGCCTACTTTATATTCTGGG + Intergenic
1085482211 11:76832041-76832063 TCCTGGCAGCTTTAAACCTTTGG - Intergenic
1085935273 11:81134089-81134111 TTCTGCAAGCTGTACATTTTGGG - Intergenic
1085964794 11:81509765-81509787 CACTGCTAGCTGTAAATTTTGGG - Intergenic
1086266752 11:85008182-85008204 TTATGAAAGTTTTAAATTTTAGG + Intronic
1086499960 11:87442605-87442627 TTCTGCCATGATTAAGTTTTAGG + Intergenic
1086544564 11:87952314-87952336 TGCAGCCAGCAGTAAATTTTAGG + Intergenic
1086549720 11:88041983-88042005 TTTTGGGAGCTTTAATTTTTGGG - Intergenic
1089570042 11:119400861-119400883 TTCCCCCAGCTTCAAATTTTTGG - Intergenic
1090540627 11:127699625-127699647 TTCTTCCAGCTTTAAGTATTGGG + Intergenic
1091189691 11:133680744-133680766 TTCTGCCTGCTTTATATTCATGG - Intergenic
1091608620 12:1982001-1982023 TACAGCCAGCTTTAAATGTTAGG + Intronic
1092627269 12:10340033-10340055 TTCTGCCATTTTTAAATTTATGG + Intergenic
1093291881 12:17335691-17335713 TTATGATAGCTCTAAATTTTAGG - Intergenic
1094152501 12:27301017-27301039 TTCTGCTAGGTTTATATTTAGGG + Intronic
1094188792 12:27675371-27675393 TTGTGCCATCTGTAAACTTTTGG + Intronic
1094773933 12:33699402-33699424 TTCTGCCAGTTTTAAAATGTTGG - Intergenic
1095612152 12:44142243-44142265 TTATGGTAGCTATAAATTTTGGG + Intronic
1097477036 12:60070917-60070939 TTCAGCCAACTTTAATTTCTTGG + Intergenic
1097535615 12:60866523-60866545 TTCTGCCATTTTAAAATTTTGGG - Intergenic
1099105938 12:78496456-78496478 TGCTGCCTGGCTTAAATTTTGGG + Intergenic
1099174514 12:79405307-79405329 TTCTGCCTGTTTGGAATTTTGGG - Intronic
1099417745 12:82413921-82413943 TTCTCCCAGTTTTATATGTTTGG + Intronic
1099608117 12:84830491-84830513 ATCTGACAGCTTTAAGCTTTTGG - Intergenic
1101505366 12:105341482-105341504 TTCTGTCAGCTATAGATTTGGGG + Intronic
1103627646 12:122232427-122232449 TTCTGAAATGTTTAAATTTTAGG - Exonic
1105882639 13:24617442-24617464 TTCTGGCATTTTTAAATTTCTGG + Intergenic
1106861975 13:33919638-33919660 TTCTGCTTGCTTTAAACTTTTGG + Intronic
1107132254 13:36909585-36909607 TTCTGGAAGCATTAAATTGTGGG - Intronic
1107268029 13:38580599-38580621 TTCTGCCTCCTTTATATTCTTGG + Intergenic
1107676659 13:42804749-42804771 TACTAACAGCTATAAATTTTTGG + Intergenic
1108296471 13:49024333-49024355 TTCTTTCTGCTTTAACTTTTTGG - Intronic
1108452253 13:50578833-50578855 TTATACCAGATTTATATTTTAGG + Intronic
1109805762 13:67440660-67440682 TTTTGCAAGCATTAAACTTTTGG + Intergenic
1110956903 13:81564247-81564269 TACTTCCAGGTTTTAATTTTTGG + Intergenic
1112773519 13:102818988-102819010 TTTTGCCAGAGTTCAATTTTGGG - Intronic
1113244046 13:108375201-108375223 TTTTGCCAGATATACATTTTAGG + Intergenic
1114718407 14:24853223-24853245 TTCTGACCTCTTTAACTTTTGGG - Intronic
1114742767 14:25115027-25115049 TTCTGCATGGTTTGAATTTTGGG + Intergenic
1114802677 14:25796189-25796211 GTCTGCAAGCCTTAGATTTTTGG - Intergenic
1115327614 14:32159636-32159658 TTTTACCAGCTTTAACTTTGGGG + Exonic
1115417924 14:33158510-33158532 TTCTGCCACCTTTAGTTCTTAGG - Intronic
1115622072 14:35150465-35150487 TTCTAGAAGCTTTACATTTTTGG - Intronic
1115705371 14:35993187-35993209 TCCGGCCTGCTTTAAATTGTGGG - Intergenic
1118337765 14:64868576-64868598 CTCTGCCAGCTTTTACTTGTTGG - Intronic
1119586578 14:75841250-75841272 TTCTGCCATTTTTGGATTTTAGG + Intronic
1120452858 14:84692250-84692272 TTTTGCCAGCTTTAAGTTAGAGG - Intergenic
1120630411 14:86883296-86883318 TTCTTCCAGTTTTACATTTGAGG + Intergenic
1121028813 14:90639948-90639970 TTTTGCCTGTTTTAAACTTTTGG - Intronic
1202914440 14_GL000194v1_random:152870-152892 TTCTGCCATCTTTAATTTACTGG + Intergenic
1202875746 14_GL000225v1_random:208626-208648 TTCTGCCATCTTTAATTTACTGG - Intergenic
1202878230 14_KI270722v1_random:29842-29864 TTCTGCCATCTTTAATTTACTGG - Intergenic
1124201626 15:27683233-27683255 TGCTGCCAGCATTGATTTTTGGG - Intergenic
1124659412 15:31533579-31533601 TTTTGCTAGCTTTAAAATTCTGG - Intronic
1125830160 15:42709991-42710013 TTGTTCCAGCTTTAATTATTTGG + Intronic
1126059329 15:44764457-44764479 TTCTGCCAGCCTTATAAATTAGG + Intronic
1126655798 15:50976011-50976033 TTCTCTCCTCTTTAAATTTTTGG - Intronic
1127013820 15:54660431-54660453 TTCTGCCAGCATTGTATTCTAGG - Intergenic
1127441458 15:59013039-59013061 TGGTTCCAGCTTTAGATTTTTGG + Intronic
1128258909 15:66218152-66218174 TTCCCCCATTTTTAAATTTTGGG - Intronic
1128950410 15:71874331-71874353 TTCTGGAAACTTTAAACTTTAGG - Intronic
1129625793 15:77197521-77197543 TTCTGTTATTTTTAAATTTTTGG + Intronic
1130104138 15:80916694-80916716 TTCTTCCAGCTCTAAAATTCTGG - Intronic
1131365988 15:91840177-91840199 TTCTGCCAGCAATTTATTTTAGG + Intergenic
1131427333 15:92356315-92356337 TCCTTCCAACTTTAAATTTGTGG + Intergenic
1131534613 15:93225560-93225582 TTGAGCCAGCTTTGCATTTTTGG + Intergenic
1131714422 15:95092860-95092882 TTCTGCCAACATTCAAATTTGGG + Intergenic
1134276573 16:12781760-12781782 TTCTGGCAGCATTCAATTTGGGG - Intronic
1134365079 16:13569659-13569681 TTTTGCCAGTTTTCAATTTCTGG - Intergenic
1135354298 16:21756852-21756874 GTCTGCCGGCTTTCCATTTTTGG + Intronic
1135452789 16:22572992-22573014 GTCTGCCGGCTTTCCATTTTTGG + Intergenic
1136118685 16:28113604-28113626 TTCTGCCTGCCTTGACTTTTTGG - Intronic
1138763443 16:59571290-59571312 TTATGCCTGCTTTAAGTTTCAGG - Intergenic
1139117305 16:63972036-63972058 TCCAGCCAGATTTAAATTTGGGG + Intergenic
1140651043 16:77088964-77088986 TTCTAGCAGCTTTACCTTTTGGG + Intergenic
1142564644 17:832073-832095 ATCTGCTAGCTTTACATTTGAGG - Intronic
1143810532 17:9467969-9467991 TTATGGCAGCTGTATATTTTAGG - Intronic
1144535449 17:16084838-16084860 TTCTGAAAGCTTTATAATTTTGG - Intronic
1145231122 17:21174043-21174065 TTCTGCCCCATTTAACTTTTTGG + Intronic
1148447459 17:47746204-47746226 TTCTGTCAGCTTTCATTTATGGG + Intergenic
1148469542 17:47884669-47884691 TTCTGCCAGCTCCAATATTTAGG + Intergenic
1149062266 17:52436527-52436549 TTCTCACAGCTTTAAAAATTAGG - Intergenic
1150665026 17:67126284-67126306 TTCTTCCAGCTTTACAATGTAGG - Intronic
1150846992 17:68669193-68669215 TTCTGACAGGTCTAAATTGTTGG + Intergenic
1152309067 17:79538141-79538163 TTCTGTCGGTTTTAAGTTTTGGG - Intergenic
1203166986 17_GL000205v2_random:106579-106601 TTGTGTCAGAATTAAATTTTGGG + Intergenic
1153289599 18:3487846-3487868 TTCTATCAGGTTAAAATTTTGGG + Intergenic
1153741648 18:8136047-8136069 TTCTTCCAGATTTGTATTTTAGG - Intronic
1154982650 18:21516290-21516312 TGCTCCCAGTTTTAAATTTCTGG - Intronic
1155468399 18:26164797-26164819 TTGTGTCTGTTTTAAATTTTCGG + Intronic
1155668572 18:28341539-28341561 TTCTCTCTCCTTTAAATTTTTGG - Intergenic
1155926856 18:31665356-31665378 TTCTACCATCATTAAATTATTGG + Intronic
1156474377 18:37396384-37396406 TTTTTCCATCTGTAAATTTTTGG + Intronic
1157091983 18:44647512-44647534 TTCCACCACTTTTAAATTTTTGG + Intergenic
1157478743 18:48039569-48039591 TCCTTCCAGCTGTAAATTTGTGG - Intronic
1159149250 18:64498899-64498921 TTCTGCCATATTTTAATTTCAGG - Intergenic
1159370348 18:67520395-67520417 TACTGCCTGCTTTAAACTTGTGG - Intergenic
1164782938 19:30908115-30908137 CTCTGCCGGCTTTTCATTTTCGG - Intergenic
1164929213 19:32161681-32161703 TTCTACCACTTTTAACTTTTTGG + Intergenic
1167051646 19:47082719-47082741 TTCTGCCATCTTTAAACATATGG - Intronic
1202672447 1_KI270710v1_random:3084-3106 TTCTGCCATCTTTAATTTACTGG + Intergenic
926390463 2:12386026-12386048 TTCTGCCTGCTTTTTATTCTGGG - Intergenic
929799593 2:45088358-45088380 TTCTTCCAGCTTTAAGTCTCTGG + Intergenic
930759843 2:55022167-55022189 GACTGCTAGCTTTAAGTTTTGGG + Intronic
930876019 2:56217419-56217441 TTCTTCTATCTTTAATTTTTTGG + Intronic
933485924 2:82923432-82923454 TTCTGCCAGTTTTACATTCCAGG - Intergenic
935566563 2:104614673-104614695 TTCTTCCAGAATTATATTTTTGG - Intergenic
936170789 2:110171243-110171265 TTCAGCAAAGTTTAAATTTTGGG + Intronic
937468671 2:122156626-122156648 TTCCCCCAGCTCTAAAGTTTGGG + Intergenic
937692390 2:124771170-124771192 AACTGCCAGATTTAAATTATCGG - Intronic
937777051 2:125790336-125790358 TTCTGACTGTTTTATATTTTGGG - Intergenic
938709208 2:133960966-133960988 TTCTCACAGCTTTCAATTCTGGG + Intergenic
939473521 2:142655807-142655829 TTATTCAATCTTTAAATTTTTGG + Intergenic
941130634 2:161645713-161645735 TTCAGCCAACACTAAATTTTTGG - Intronic
941896483 2:170634172-170634194 TTCTTCCAGCTTTGTTTTTTTGG - Intronic
942041729 2:172072071-172072093 TTTTGACAGTTTTAAATTATAGG + Intronic
942121266 2:172779950-172779972 TAATGCCAGTTTTCAATTTTTGG + Intronic
943874124 2:193040466-193040488 TTATGCCAGTTTTCCATTTTAGG + Intergenic
946521258 2:220467495-220467517 TTCTGGCTGATTTATATTTTGGG + Intergenic
946756910 2:222956571-222956593 TTCTGCTTACTTTCAATTTTGGG + Intergenic
1169607450 20:7338452-7338474 TTCTGCCTACTATAAATTATGGG - Intergenic
1169639798 20:7738639-7738661 TTCTGCAATTTTTAAATTTAAGG + Intergenic
1169755788 20:9041701-9041723 TTCTCCCAGCTGTAAAATCTTGG - Intergenic
1170656717 20:18293572-18293594 TTATTCCAGCTTTAAACATTGGG - Intronic
1170777419 20:19389900-19389922 TTCTTCACTCTTTAAATTTTTGG + Intronic
1171880258 20:30613402-30613424 TTCTGCCACCTGTAAATTGAGGG - Intergenic
1174495243 20:50936590-50936612 TTCTTTCAACTTTAAATTTTAGG - Intronic
1174879804 20:54266905-54266927 ATCTACCAGCTCTAAATTGTTGG + Intergenic
1176334580 21:5583981-5584003 TTGTGTCAGAATTAAATTTTGGG - Intergenic
1176393177 21:6236967-6236989 TTGTGTCAGAATTAAATTTTGGG + Intergenic
1176404771 21:6352520-6352542 TTGTGTCAGAATTAAATTTTGGG - Intergenic
1176432386 21:6636584-6636606 TTGTGTCAGAATTAAATTTTGGG + Intergenic
1176468242 21:7079207-7079229 TTGTGTCAGAATTAAATTTTGGG - Intronic
1176491803 21:7460985-7461007 TTGTGTCAGAATTAAATTTTGGG - Intergenic
1176508839 21:7677398-7677420 TTGTGTCAGAATTAAATTTTGGG + Intergenic
1176633794 21:9167515-9167537 TTCTGCCATCTTTAATTTACTGG + Intergenic
1177671411 21:24235053-24235075 TGCTGCCAGCCATTAATTTTTGG + Intergenic
1177846097 21:26288869-26288891 TAATGTCAGCTTCAAATTTTTGG + Intergenic
1179464121 21:41560392-41560414 TTATGACAGATTTCAATTTTCGG - Intergenic
1179839495 21:44062147-44062169 TTCTCTCAGTTTTAAAATTTGGG + Intronic
1180389649 22:12215529-12215551 TTCTGCCATCTTTAATTTACTGG + Intergenic
1180754166 22:18148832-18148854 TTCTGGCAGCTTTGGGTTTTTGG + Intergenic
1182138150 22:27926206-27926228 TTCTGCAAGTTTTAAAGTTTTGG + Intergenic
1182174776 22:28273030-28273052 TTGTCCCAGCTTTAAATCTGAGG - Intronic
1184010046 22:41740758-41740780 TTCCACCACCTTTAAATTCTTGG - Intronic
1184518002 22:44974971-44974993 TTCTTTCAGCTTTGAATTGTAGG - Intronic
949156211 3:830129-830151 TTCTGGCTGCTTTCAATTGTTGG + Intergenic
949194903 3:1293432-1293454 TTTTGCCACCTTTTACTTTTGGG + Intronic
949347468 3:3089944-3089966 TTCTGCAAGCTTTAAAGTGCTGG - Intronic
949876641 3:8630262-8630284 TACTGCCTGCTTTACACTTTTGG - Intronic
951399115 3:22208809-22208831 TTTTGCCAGCTTGTAAATTTTGG - Intronic
951922088 3:27866453-27866475 TTCTGTCCGCTTTACGTTTTTGG + Intergenic
955608096 3:60728140-60728162 TTCTACCAGCTCTAAATTCGTGG + Intronic
957100667 3:75823524-75823546 TTCTGCCATCTTTAATTTGCTGG + Intergenic
957152452 3:76503240-76503262 TTCTGCCTGCTTTATATTCGCGG + Intronic
957597143 3:82281467-82281489 TTTTGTCAGCTCTAAATTATGGG - Intergenic
958028755 3:88081631-88081653 TTGTGCCAGCTTTAGCCTTTAGG + Intronic
959073492 3:101725469-101725491 TTCTGGGAGCTGTAAATTCTTGG + Intronic
959810559 3:110614120-110614142 TGCTTCCAGCTTTAAATAATAGG - Intergenic
960191213 3:114708348-114708370 TTTTGCCAGTTTTATTTTTTCGG - Intronic
962929696 3:140024984-140025006 TTCTTCCAGCTCAAAATTCTTGG - Intronic
962967465 3:140368009-140368031 TTCTCCCTGATTTAGATTTTAGG - Intronic
963312805 3:143727288-143727310 CTCTGCCAGCCATAAAATTTTGG + Intronic
963371752 3:144410045-144410067 TTCTGGCAGTTTTATAGTTTTGG + Intergenic
964632017 3:158821080-158821102 TTCTGCCAGACTTAAATTCTGGG + Intronic
964808624 3:160638773-160638795 TTCTGCCTGCTTTATATTCTAGG - Intergenic
964887087 3:161496791-161496813 TTCTTCCAGCTTCAAATATGTGG + Exonic
965413458 3:168362428-168362450 TTCTTCCAGCTGTAAAATTGTGG + Intergenic
965863848 3:173181662-173181684 TTCTGCTATCTTCAAATGTTTGG + Intergenic
966025800 3:175279665-175279687 TTCTTCCTGCTTCAAATTTCAGG - Intronic
966569467 3:181424961-181424983 TTCCTCCAGCTTTAACATTTGGG - Intergenic
966691410 3:182745717-182745739 TTATGTCAAATTTAAATTTTAGG + Intergenic
968246745 3:197157928-197157950 TTCTAACAGTTTTAAGTTTTAGG - Intronic
968799899 4:2735364-2735386 TTCTGCTAATTTTAAAATTTAGG - Intergenic
968893231 4:3383651-3383673 TTCAAACAGCTTTAAATTTATGG - Intronic
970191055 4:13519135-13519157 TTCTGCCATTTCTAAATATTGGG + Intergenic
971144839 4:23965302-23965324 CTCTGCCATCAATAAATTTTTGG - Intergenic
971610593 4:28720685-28720707 TTCTGCAAGCTTTCATCTTTTGG - Intergenic
971961421 4:33492366-33492388 TTCTGTCCTCTTTAATTTTTTGG + Intergenic
971988355 4:33857609-33857631 ATTTGACAGCTGTAAATTTTGGG + Intergenic
972149775 4:36075117-36075139 TTCTCCCAGGTTTATGTTTTGGG - Intronic
972501107 4:39678790-39678812 TTCAGTCAGCTTTAATTTGTAGG + Intergenic
972552068 4:40143188-40143210 TTCTGTCATGTTTGAATTTTTGG + Intronic
973201371 4:47506429-47506451 ATCTACAAGCTTTCAATTTTAGG - Intronic
974179911 4:58371265-58371287 TTCTGCCTGCTTTTATTTTCTGG - Intergenic
975949476 4:79751268-79751290 TTCTGTCCTCTTTAATTTTTTGG - Intergenic
976621441 4:87132099-87132121 TTCTACCAGCATTTACTTTTGGG + Intronic
977499912 4:97825247-97825269 ATCTGACAACTTTAACTTTTGGG + Intronic
977627046 4:99198908-99198930 TTCTGCCTGCTTTTAAATTCTGG + Intergenic
978093712 4:104749438-104749460 TGCTGCCAGCCAGAAATTTTAGG + Intergenic
978137921 4:105285252-105285274 TTCTCTCACCTTTAATTTTTTGG + Intergenic
978877085 4:113654225-113654247 CTCTTCCAGTTTTAAATTTTAGG + Intronic
979029090 4:115617457-115617479 TTCTGTAAGTTTTAAATTTTAGG + Intergenic
979302727 4:119106193-119106215 TTGTGCCAGCTGCAAATTTCTGG - Intergenic
980379851 4:131999337-131999359 TTCTTTCAGTATTAAATTTTTGG + Intergenic
981873855 4:149517733-149517755 TTCTGCCTGCTCTATATTCTGGG - Intergenic
982322889 4:154098530-154098552 TTCAGCCACCTTGAAAGTTTAGG + Intergenic
983797359 4:171881462-171881484 TTCTGCCTGCTTTATATCTCTGG + Intronic
984425304 4:179576991-179577013 TTCCTCCTGCTTAAAATTTTTGG - Intergenic
984549296 4:181141698-181141720 TTATGCCACATTCAAATTTTTGG - Intergenic
986375070 5:7122639-7122661 TTTTTCCAGCTTTTAAGTTTGGG + Intergenic
986550487 5:8948837-8948859 TTTTGGCATCTTTAAGTTTTGGG - Intergenic
988188238 5:27896227-27896249 TTCTGTCAGCTCTTAATGTTAGG + Intergenic
988238962 5:28583285-28583307 TTTTGCCAAATTAAAATTTTTGG - Intergenic
988679101 5:33466743-33466765 TTTTGCCAGCTTTAAATTCCTGG + Intronic
990941796 5:61209573-61209595 TTTTGCTAGATTTAAATCTTTGG + Intergenic
991240923 5:64458989-64459011 CACTGGCAGCTTTAAATGTTGGG - Intergenic
992684546 5:79186843-79186865 TTCTTACACCTTTGAATTTTAGG - Intronic
993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG + Intergenic
993362604 5:86997034-86997056 TTCTGGCAGTTTTATAGTTTTGG + Intergenic
994268035 5:97740450-97740472 TTATGCTAACTTTTAATTTTTGG - Intergenic
994805137 5:104436807-104436829 TTCTGCCTACTTTATATTCTAGG - Intergenic
996017115 5:118551897-118551919 GTCTGCCAGTTTTAACTTTTTGG - Intergenic
996606925 5:125334312-125334334 TTCTGCCTGCTTTACATTCTAGG + Intergenic
996902415 5:128557588-128557610 TTCTGCCAGGTTTTAATATCAGG - Intronic
996927863 5:128849970-128849992 TTAAGTCATCTTTAAATTTTTGG - Intronic
999571031 5:152919807-152919829 TTCAGCCATCTTTAAAGTTCCGG + Intergenic
1000028841 5:157384309-157384331 TTCAGCAAGCTTCACATTTTGGG + Intronic
1000278969 5:159765524-159765546 TACTGTAAGCTTTAACTTTTCGG + Intergenic
1001129226 5:169049782-169049804 TTCTGCCCACTTTAGAGTTTAGG - Intronic
1001587209 5:172841129-172841151 TGTTGTCAGCTTTAACTTTTAGG + Intronic
1003908532 6:10723270-10723292 TTCTGCCACTTTTAACTTTTAGG + Intronic
1003911518 6:10747917-10747939 TTCTGCCACTTTTAACTTTTAGG + Intronic
1004345943 6:14849469-14849491 TTCTGCCAGCTTTTGTTTTATGG - Intergenic
1006707505 6:36033795-36033817 TTCTTCCATCTTTGAATTCTAGG - Intronic
1007412169 6:41671307-41671329 TTCTACCAGCATGAAATTTGGGG - Intergenic
1007916160 6:45563498-45563520 TTCTGACATCTATAAAATTTAGG + Intronic
1008046924 6:46860565-46860587 TTCTGCCAGCTATGGCTTTTAGG - Intronic
1009496906 6:64360570-64360592 TTTTGTCAGGTTAAAATTTTTGG + Intronic
1012468652 6:99544840-99544862 TTCTGTCAGCTTTAAATTTATGG + Intronic
1014419084 6:121218579-121218601 TTCTGCCTGCTTTATATTCTAGG - Intronic
1014455573 6:121630542-121630564 TTCTGCCTTCATTAAATTTAAGG + Intergenic
1014550679 6:122786885-122786907 TTTTCCTAGCTTTAAATGTTTGG + Intergenic
1014632796 6:123807292-123807314 TTATGCCAACTTCAGATTTTAGG + Intronic
1015148409 6:130013323-130013345 TTCTGGCACCTTTATCTTTTGGG + Intergenic
1016583190 6:145652916-145652938 TTCTGACTGCTTTAAATATAAGG + Intronic
1017273351 6:152535441-152535463 TTCTGTCAGCCTAAAATTTATGG - Intronic
1017642221 6:156505361-156505383 TTATGCCAGCTCTAAATTTCGGG + Intergenic
1020969809 7:14921678-14921700 TTCTGCCATGTTGACATTTTGGG - Intronic
1021200867 7:17727334-17727356 ATCTGCCAGCTTTATATTCAAGG + Intergenic
1022817604 7:33928482-33928504 TTCTGCCATCTCTAATGTTTTGG + Intronic
1023227843 7:37990409-37990431 TTCTGCCAGCTTGACACTATAGG - Intronic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1023784831 7:43695688-43695710 TTTTACCAGACTTAAATTTTTGG - Intronic
1026387716 7:69867032-69867054 TTCTGCCAGCTTCAGCCTTTAGG + Intronic
1026476573 7:70741316-70741338 TTCTGTCAGTGATAAATTTTTGG - Intronic
1027358777 7:77386147-77386169 TTCTTCCAGAATTATATTTTTGG - Intronic
1027739905 7:81988269-81988291 TATTGCCACCTTTCAATTTTTGG - Intronic
1028152111 7:87386198-87386220 TTCTGCCCTCTTCAATTTTTTGG + Intronic
1028278892 7:88895760-88895782 TTGTTCCAGCTTTGAATATTCGG - Intronic
1028785648 7:94790063-94790085 TTGTGCCAGTTTTCAAGTTTTGG + Intergenic
1029219224 7:98974673-98974695 TTTTTCCAGCATTATATTTTCGG - Intronic
1030982093 7:116198167-116198189 TTCTGCAATCATCAAATTTTAGG - Intergenic
1030984387 7:116223989-116224011 TTCTGCCACATTTCATTTTTTGG - Intronic
1030999267 7:116395969-116395991 TTCAGCCAGCCTTGAATGTTTGG - Intronic
1031696010 7:124855293-124855315 TTCAGACACTTTTAAATTTTAGG - Intronic
1031932625 7:127701626-127701648 TTTTGCTACCTTTAAGTTTTAGG - Intronic
1031934152 7:127718632-127718654 TTCTTAGAGCTGTAAATTTTAGG - Intronic
1032816519 7:135480978-135481000 TTTTTCCAGTTTTATATTTTTGG - Intronic
1035930531 8:3775519-3775541 TTCTCCCTGCTTTTAATATTAGG - Intronic
1036274780 8:7340934-7340956 TTCTGGCAAATATAAATTTTCGG + Intergenic
1036346574 8:7969412-7969434 TTCTGGCAAATATAAATTTTCGG - Intergenic
1036841901 8:12130165-12130187 TTCTGGCAAATATAAATTTTCGG - Intergenic
1037117315 8:15242361-15242383 TGCTTCCAGTTTCAAATTTTTGG - Intergenic
1037657513 8:20898016-20898038 TTCTTGCATCTTTAAATGTTGGG + Intergenic
1038058338 8:23883550-23883572 TTTTTCCAGAGTTAAATTTTGGG - Intergenic
1038971601 8:32642728-32642750 TTTTGCCAGCCGTAAAATTTAGG + Intronic
1041920301 8:63175424-63175446 TTCTGACAGTTTCAGATTTTAGG + Intronic
1042082857 8:65074852-65074874 TTCTACCAACTTGAAAATTTTGG + Intergenic
1042143398 8:65702564-65702586 TTCTACCAACTTTATATTTCAGG + Intronic
1042947868 8:74173122-74173144 TTCCTCCAGCTTAAAATTTGTGG - Intergenic
1043690977 8:83151169-83151191 TTCTGCCTGTTTTATATTCTGGG - Intergenic
1043763451 8:84099079-84099101 TGCTTCCAGCTTTATTTTTTTGG + Intergenic
1043916192 8:85925309-85925331 TCCTGCCAGCTCTGGATTTTTGG - Intergenic
1044185582 8:89246981-89247003 TCCTAACAGCTTTATATTTTGGG + Intergenic
1044333971 8:90954133-90954155 TTCTTTCAGATTTTAATTTTAGG - Intronic
1044520440 8:93193229-93193251 TTCTGCAACCTGTAACTTTTGGG - Intergenic
1046238292 8:111456732-111456754 TTCAGCCAGCTTTATCTTTAGGG - Intergenic
1046750624 8:117923028-117923050 GCCTGGCAGTTTTAAATTTTGGG - Intronic
1047217730 8:122891077-122891099 TTCTCTCTGCTTTAATTTTTTGG + Intronic
1048435435 8:134412542-134412564 TACTGCCACCATTAAATGTTGGG - Intergenic
1048594148 8:135848769-135848791 TGCTGCCAGCTTTGTTTTTTTGG + Intergenic
1048840406 8:138560869-138560891 TTCTGACAGCTTTCACTATTTGG + Intergenic
1050129048 9:2390461-2390483 TTCTGCCAGCTATAAAAATTGGG + Intergenic
1052158084 9:25219941-25219963 TTCTGCCAGCATAAAATATTGGG - Intergenic
1052178087 9:25489060-25489082 TTCTGCCCCTTTTCAATTTTGGG - Intergenic
1052664621 9:31478696-31478718 ATATACCAGCTTTAAATTCTTGG - Intergenic
1053026470 9:34733430-34733452 TTTTGCCACATGTAAATTTTTGG + Intergenic
1053460396 9:38264993-38265015 TTTTGACAGATTTATATTTTGGG - Intergenic
1057561225 9:96129476-96129498 TTCTGTTAGCTTTAAAATTGTGG + Intergenic
1058158370 9:101540231-101540253 TTCTGCCAGCTTGCGATTTTTGG - Exonic
1058189334 9:101893750-101893772 TTCTTCCTGCTTTCAGTTTTGGG + Intergenic
1059247198 9:112858591-112858613 TTCTTCCACCTTTGATTTTTTGG - Intronic
1062336263 9:136070687-136070709 TTCTGCTTGCTTCAAGTTTTTGG - Intronic
1203427050 Un_GL000195v1:50940-50962 TTGTGTCAGAATTAAATTTTGGG + Intergenic
1203439152 Un_GL000195v1:172128-172150 TTGTGTCAGAATTAAATTTTGGG - Intergenic
1203756634 Un_GL000218v1:135159-135181 TTCTGCCATCTTTAATTTACTGG + Intergenic
1187691438 X:21872081-21872103 TTCTGTCATCTTAAAAGTTTTGG - Intronic
1190336883 X:49268017-49268039 ATTTGCCAGCTTGAACTTTTAGG + Intergenic
1191193393 X:57691449-57691471 TTCTTCCAACTTTACTTTTTTGG + Intergenic
1192487234 X:71538912-71538934 TACTGACAGCTTTAAATGATTGG + Intronic
1194378787 X:93168146-93168168 TTCTCCCATTTTTTAATTTTTGG - Intergenic
1194555709 X:95356107-95356129 TTCTGCCACCTTTAATATATTGG + Intergenic
1195540445 X:106056912-106056934 TTCTGCCTGCTTTAATATTCTGG + Intergenic
1195745736 X:108116226-108116248 TACTGCCAGAGTTAAGTTTTGGG - Intronic
1197574544 X:128194367-128194389 TTGTGTAATCTTTAAATTTTTGG - Intergenic
1197956872 X:131960470-131960492 TTCTGTCAGCTTTGTTTTTTTGG - Intergenic
1199160608 X:144606835-144606857 TTCTGCCTGCTTTAAGTCTGTGG - Intergenic
1200382828 X:155857768-155857790 CTGGGACAGCTTTAAATTTTTGG - Intergenic
1200877549 Y:8173965-8173987 TTCTGTCAGTTAAAAATTTTTGG + Intergenic
1201170212 Y:11252772-11252794 TTCTGCCATCTTTAATTTACTGG + Intergenic
1202336704 Y:23819431-23819453 TTCAGCCATCTTTAAAAATTTGG - Intergenic
1202534061 Y:25850640-25850662 TTCAGCCATCTTTAAAAATTTGG + Intergenic