ID: 1064379246

View in Genome Browser
Species Human (GRCh38)
Location 10:14825668-14825690
Sequence CAGTATCATTCCAGTAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064379245_1064379246 -5 Left 1064379245 10:14825650-14825672 CCAGACAATGAAGACATTCAGTA 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1064379246 10:14825668-14825690 CAGTATCATTCCAGTAATGAAGG 0: 1
1: 0
2: 1
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064379246 Original CRISPR CAGTATCATTCCAGTAATGA AGG Intronic
905681575 1:39875988-39876010 TATGATCATTCCTGTAATGAGGG + Intronic
908160946 1:61407919-61407941 CATTATTATTCCAATACTGAAGG - Intronic
908509281 1:64838699-64838721 AAGTAACATGCCTGTAATGAAGG - Intronic
910409081 1:86921549-86921571 CAGTATTAATACAGTTATGAGGG - Intronic
910535993 1:88298325-88298347 CAGTTTCATCCCAATAATGCTGG - Intergenic
910611565 1:89149238-89149260 AAGTATCATTCCAGAAAGGCAGG + Intronic
915719072 1:157970834-157970856 CAGTATCATGCCATTGATGAAGG + Intergenic
917183830 1:172329118-172329140 CAGAATCATTGCAGTAGGGAGGG + Intronic
918479174 1:184959138-184959160 CAGGATCAGTTCAGAAATGAGGG - Intronic
920389874 1:205592712-205592734 CAGAATGATCCCCGTAATGATGG + Intronic
921984897 1:221302310-221302332 AAGTATCACTCCTGTAATAAAGG - Intergenic
922194858 1:223351230-223351252 CTGTATCATTCTAGAGATGAGGG - Intronic
924756738 1:246947965-246947987 CATTATCCTTCCAGTATTCAAGG - Intronic
1063018273 10:2100274-2100296 CAACATCATTTCAGGAATGAAGG - Intergenic
1064379246 10:14825668-14825690 CAGTATCATTCCAGTAATGAAGG + Intronic
1067798386 10:49337815-49337837 CAGTATTAATCCATTCATGAGGG - Intergenic
1068341174 10:55704899-55704921 CAGCATTGTTCCAGTTATGATGG + Intergenic
1068835250 10:61545729-61545751 CTGTGTCATTCTAGCAATGAAGG - Intergenic
1070342988 10:75514572-75514594 CAGTATCAAGCCATTCATGATGG - Intronic
1070730595 10:78825281-78825303 CAGCATCAATCCATTCATGAGGG - Intergenic
1071297795 10:84234806-84234828 CAGCATCATCCCGGCAATGAAGG + Intronic
1075917409 10:126180844-126180866 TAGTATAATTGCAGTAACGATGG - Intronic
1079907386 11:26265994-26266016 CAGAATGTTTCCAGTAAAGATGG - Intergenic
1080747460 11:35121085-35121107 CTGAATCTTTCCAGTACTGAGGG - Intergenic
1081319192 11:41669272-41669294 CTGTAGCATTTCAGTACTGATGG - Intergenic
1082795058 11:57372759-57372781 CAGTATCCTTACAGTAAAGCTGG - Intergenic
1088921949 11:114266022-114266044 CAGTTTCATTCCTGTAATTTAGG + Intronic
1092701277 12:11233787-11233809 CAGCATCAAGCCATTAATGAGGG + Intergenic
1097653016 12:62326514-62326536 CAGAAACATTACAGTAATGGAGG - Intronic
1098819963 12:75214704-75214726 CAGCATTATTCCATTTATGAAGG + Intergenic
1100911821 12:99372932-99372954 CAATATCATTCCAGAAATTAGGG - Intronic
1101538973 12:105646881-105646903 CAGTGTTAGTCCACTAATGAAGG - Intergenic
1102635222 12:114317444-114317466 CAGCATCATTGCAGTAGGGATGG - Intergenic
1102822791 12:115922630-115922652 CATTTTCATTCCTGTAATCATGG - Intergenic
1102836542 12:116067063-116067085 CAGTATATTTCCAGTATTGCAGG - Intronic
1103579552 12:121904136-121904158 CAGTATCAGTGCAGAAACGATGG - Intronic
1105017657 12:132795793-132795815 CAGCATCATTCCTGCAAGGAGGG + Intronic
1106191426 13:27457015-27457037 GAGTATCAGTCCAGGCATGATGG + Intergenic
1106936901 13:34732435-34732457 CAGTGTCATTCCAGGAAGAATGG - Intergenic
1107190120 13:37572238-37572260 CAGTTGCATTCCACTATTGAAGG - Intronic
1107798610 13:44081589-44081611 CAGAAGCATTCTAGTAATAAAGG - Intergenic
1108190764 13:47936491-47936513 TTGTATCATTCCAGTTTTGAAGG + Intronic
1108788880 13:53942176-53942198 CAGTATCATTACAATAGTCAGGG - Intergenic
1110559264 13:76892729-76892751 CAGAATCACTCAAGTGATGAGGG - Intergenic
1111462003 13:88557319-88557341 CAGTACCAATTAAGTAATGAAGG - Intergenic
1115542837 14:34438851-34438873 AAGGATCATTCTAGTAAAGAGGG - Intronic
1116298939 14:43151389-43151411 CAGCATTAATCCAGTCATGAGGG + Intergenic
1119846729 14:77836069-77836091 CAGCATTATTCCATTCATGAGGG - Intronic
1121963840 14:98286249-98286271 CAGTATGAATCCATTTATGAGGG + Intergenic
1124039353 15:26085937-26085959 TAGTATCATGCCTGAAATGAAGG + Intergenic
1124431140 15:29609451-29609473 CAGTATTAATCCATTCATGAGGG - Intergenic
1126271978 15:46830087-46830109 CAGTATTTTTCCAGTGCTGAAGG + Intergenic
1126363102 15:47866269-47866291 CAGAATCAAGCCATTAATGAGGG + Intergenic
1129570393 15:76676942-76676964 CAGTATCTTTCAAGTAAAGAGGG + Intronic
1130717629 15:86351292-86351314 CAGCATTAATCCATTAATGAGGG + Intronic
1131843239 15:96460905-96460927 CAGTATTAATCCATTCATGAGGG + Intergenic
1134858618 16:17541038-17541060 CTGGAACATTCCAGAAATGAAGG - Intergenic
1136180907 16:28551262-28551284 CAGCAACATTTCAGTTATGATGG - Intergenic
1138770288 16:59654554-59654576 CAGCATTATTCCTGTAATGATGG - Intergenic
1142362454 16:89633888-89633910 CAGTCTCCTTCCTGTAATGTGGG - Intronic
1145718976 17:27050274-27050296 CAGTATCACTGCAGTAGTAATGG - Intergenic
1145856940 17:28168555-28168577 CAATAGCATTGCTGTAATGACGG - Exonic
1147250653 17:39151116-39151138 CAGTATCCTTCCAGGAGAGAAGG + Intronic
1148109510 17:45136742-45136764 CAGTTTCATTTCAGTGATGTAGG - Exonic
1149253811 17:54801332-54801354 CAGCAGAATTCCAGTAATGATGG + Intergenic
1150889314 17:69128619-69128641 CTGAATCATTCCAGTAGTAAAGG + Exonic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1153966743 18:10189516-10189538 TAGTATGATTCCAATAAGGATGG - Intergenic
1154021227 18:10665704-10665726 CTGCATCCTTCAAGTAATGAGGG - Intergenic
1155668373 18:28338318-28338340 TATTATCATTGCAGTAATAAAGG + Intergenic
1158894300 18:61898667-61898689 CAGTGTCATGCCAGTAAATAGGG + Intergenic
1159090438 18:63842470-63842492 AAATATCATTCTAGTAATGGTGG + Intergenic
1159294763 18:66470593-66470615 CAATATTATTCCATTCATGAGGG - Intergenic
1167394298 19:49217726-49217748 CAGCAGCATCCCAGTAAAGAAGG - Intergenic
927917426 2:26945994-26946016 CAGTCTCATTCCTGAGATGATGG + Intronic
930130130 2:47841325-47841347 TAGAAACATTCCAGTAATGAAGG + Intronic
932690563 2:73909395-73909417 CAGAAACATTCCAGTATTGTTGG - Intronic
933500812 2:83108906-83108928 CAGTATCATTGGAGTGGTGAGGG + Intergenic
934637425 2:96003123-96003145 CAGCACTAATCCAGTAATGAGGG - Intergenic
935024485 2:99263146-99263168 CAGCATTATTCCATTCATGAGGG + Intronic
937647399 2:124281089-124281111 CTGTAACACTCCAGCAATGAGGG + Intronic
938789122 2:134661007-134661029 CAGCATCAATCCATTAATGAGGG - Intronic
940844193 2:158622169-158622191 GAGAATAATTCCAGTGATGATGG - Intronic
943052849 2:182937552-182937574 CTGTATCCTTCAAGCAATGAGGG + Intronic
944767444 2:202878824-202878846 GAGTATCAATCCATTAATAATGG + Exonic
944835131 2:203571756-203571778 CAGTGTCATTCCAATGATGTTGG - Intergenic
946280643 2:218663461-218663483 AAGTACCAATCCAGTGATGAAGG - Intergenic
948181861 2:235988638-235988660 CTGTAACTTTCCAGTAATGAGGG + Intronic
1169966495 20:11223506-11223528 CATTATCACTCCAGGAATCATGG + Intergenic
1171265266 20:23766597-23766619 CAGGATACTTCCAGGAATGATGG - Intergenic
1174263052 20:49311375-49311397 CAGTGTGACTCCAGTGATGATGG + Intergenic
1177571393 21:22891513-22891535 CTGTATCAATCCATTGATGAGGG + Intergenic
1178282706 21:31297235-31297257 CTGTATGATTCCACTAATGCGGG + Intronic
1179353064 21:40631672-40631694 CAGATTCATTCCAGTAAACATGG - Intronic
1181545732 22:23601232-23601254 GAGTATGATTCCATTTATGAAGG - Intergenic
951405351 3:22290221-22290243 TAGCACCATTCCAGTAAGGAAGG - Intronic
953874024 3:46654499-46654521 CTGTATGATTCTATTAATGACGG + Intergenic
956767795 3:72498596-72498618 CAGCATTATTCCATTCATGAAGG + Intergenic
957736607 3:84211705-84211727 CAGTATTAATCCATTCATGAGGG - Intergenic
958000961 3:87748473-87748495 CAGTTTCAGTGCAGTGATGAGGG + Intergenic
958475376 3:94574318-94574340 CAATCTCATTCCAGTTATGCTGG + Intergenic
959632831 3:108528054-108528076 CAGTATTAATCCGTTAATGAGGG + Intronic
964028068 3:152102482-152102504 CAGCATCAAGCCATTAATGAGGG - Intergenic
964632252 3:158824162-158824184 CAGTATCATACCAGCAATGATGG - Exonic
965388684 3:168077202-168077224 ATGTATCATTACAGTAGTGAGGG - Intronic
970890679 4:21040621-21040643 AAGTAGCATTGCAGTAAAGAAGG - Intronic
972902642 4:43703543-43703565 CAGCATAGTTCCAGTAGTGATGG - Intergenic
975940860 4:79644080-79644102 CAGGATCCTTACAGTCATGACGG + Intergenic
979210987 4:118102599-118102621 TAAAATCATTCTAGTAATGAAGG + Intronic
979617614 4:122761726-122761748 CAGTATTAATCCATTCATGAGGG - Intergenic
979747798 4:124239353-124239375 CAGTAGAATTCCAGCAATGATGG + Intergenic
981162149 4:141510894-141510916 CAGTATTTGTCTAGTAATGAAGG + Intergenic
982317959 4:154050281-154050303 AAGTATCATTACAATAATCAAGG - Intergenic
982518711 4:156386337-156386359 AAGCATGATACCAGTAATGAAGG + Intergenic
985311514 4:188604954-188604976 CTGTAACATTCCAGGCATGAAGG + Intergenic
987898909 5:23984891-23984913 CAGTATCTTTCAAGAACTGAAGG + Intronic
987985928 5:25145660-25145682 CAGCATCAATCCATTTATGAAGG - Intergenic
988153046 5:27412199-27412221 CAGTATCTTGCCATTAGTGAAGG - Intergenic
989243607 5:39228539-39228561 CAGTTTCTTTCCAGAACTGAAGG + Intronic
993655190 5:90569176-90569198 CAGTATTGTTCCATTCATGAGGG + Intronic
994514169 5:100749622-100749644 TAGAGTCATTCCAGTGATGATGG - Intergenic
995938779 5:117552292-117552314 CAGTACCATTGCAGTACTAAAGG - Intergenic
1006338200 6:33431846-33431868 CAGTAAAACCCCAGTAATGAAGG - Intronic
1007186324 6:39975351-39975373 AAGTATCTTTCCAGAAATCATGG - Intergenic
1008835711 6:55825427-55825449 CACTATCAGTCCATTAATCATGG - Intronic
1009990641 6:70839081-70839103 CAGTATTATTCCAACAATAATGG - Intronic
1012941896 6:105424295-105424317 GAGTATGAATCCAGTACTGAGGG - Intergenic
1013155318 6:107488046-107488068 CACTATCATTCCAGGAGTGGGGG + Intergenic
1014970597 6:127810449-127810471 CAGCATTAATCCATTAATGAGGG - Intronic
1021147175 7:17103221-17103243 CAGTATCCTTCTTGCAATGATGG - Intergenic
1022393822 7:29967301-29967323 AAGTATCTTTTCAGTAATTATGG - Intronic
1023116699 7:36869740-36869762 CATTATCATTCCATTACAGAGGG - Intronic
1023642645 7:42275880-42275902 AAGTACCATTTCAGAAATGATGG - Intergenic
1027938751 7:84644236-84644258 AAGTATCATTCCATCATTGAAGG - Intergenic
1028420941 7:90632205-90632227 CAGTATGATTCCACCAATGCAGG - Intronic
1029199776 7:98831117-98831139 CCATATCAATCCTGTAATGAGGG - Intergenic
1030441152 7:109591635-109591657 CAGTATCATTTCAGTGATTGGGG - Intergenic
1032384700 7:131513618-131513640 CAGTCTCATTCCAGCCGTGACGG + Intronic
1034927842 7:155137463-155137485 CAGTATAATTCTAATAATCACGG - Intergenic
1036437867 8:8751998-8752020 AAGTCTCATTCCTCTAATGAGGG + Intergenic
1037186393 8:16068523-16068545 CAGTATCTTTGCATTAATGAAGG - Intergenic
1038696356 8:29810218-29810240 CAGTAGCATGCCAGTTATCATGG - Intergenic
1039572978 8:38601968-38601990 CAGTCTCATTCCAGCAGTTAAGG + Intergenic
1041135833 8:54757905-54757927 CATTACTAGTCCAGTAATGATGG - Intergenic
1043360823 8:79469971-79469993 CAGTATTAATCCATTAATGAGGG - Intergenic
1045996144 8:108364511-108364533 CAGTATCAAGCCATTCATGAAGG + Intronic
1050649725 9:7762949-7762971 CAGAATCATTACAGTAATAATGG - Intergenic
1050712504 9:8481696-8481718 CAGAATCATTGAAGCAATGAGGG - Intronic
1055128835 9:72751309-72751331 CTGTAAAATTCCAGTAATGGGGG + Intronic
1058548926 9:106092339-106092361 GAGTATTAATCCACTAATGAAGG + Intergenic
1058938278 9:109789548-109789570 CAGAATCCTTCCAAAAATGAAGG - Intronic
1187678797 X:21745072-21745094 CAGCATTATTCTAGTAAGGATGG - Intronic
1190443921 X:50503980-50504002 CAGCAACTTTCCAGCAATGATGG - Intergenic
1193208383 X:78776228-78776250 GAGTTTCATACCAGTAATGCAGG - Intergenic
1193354657 X:80504034-80504056 GAGTTTCATCCCAGAAATGAAGG + Intergenic
1193448061 X:81629449-81629471 CAGTATCAAACCAATAATGCTGG + Intergenic
1193794062 X:85851836-85851858 CAGTATCATTCCTGCCCTGAGGG - Intergenic
1194261661 X:91703051-91703073 CAGTCTCATTCCAGTTAGAATGG + Intergenic
1195555976 X:106224772-106224794 CAGTATTAATCTATTAATGAGGG - Intergenic
1197443473 X:126519121-126519143 CAGTATTATTGCAGTAAACATGG + Intergenic
1197652702 X:129083288-129083310 CAGTATCAGTCAATGAATGAAGG + Intergenic
1198956513 X:142137118-142137140 AAGTACCATTCCAGTAGTGGTGG + Intergenic
1199477835 X:148265375-148265397 CAGCATCAATCCATTCATGAAGG + Intergenic
1200580311 Y:4941844-4941866 CAGTCTCATTCCAGTTAGAATGG + Intergenic