ID: 1064380463

View in Genome Browser
Species Human (GRCh38)
Location 10:14837774-14837796
Sequence CAGCTGCTGCGCCGCAGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064380459_1064380463 -3 Left 1064380459 10:14837754-14837776 CCAGGAGAAGCCAAAGCCGACAG 0: 1
1: 0
2: 2
3: 4
4: 170
Right 1064380463 10:14837774-14837796 CAGCTGCTGCGCCGCAGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 212
1064380458_1064380463 3 Left 1064380458 10:14837748-14837770 CCAGGGCCAGGAGAAGCCAAAGC 0: 1
1: 0
2: 3
3: 55
4: 337
Right 1064380463 10:14837774-14837796 CAGCTGCTGCGCCGCAGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 212
1064380454_1064380463 26 Left 1064380454 10:14837725-14837747 CCTGGGCGGAATGTTATTTATAG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1064380463 10:14837774-14837796 CAGCTGCTGCGCCGCAGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064380463 Original CRISPR CAGCTGCTGCGCCGCAGCGC GGG Intronic
900325175 1:2105213-2105235 CACCTGCTGGGCGGCAGTGCCGG - Intronic
901053203 1:6436044-6436066 CAGCTGCTGGGGCACAGCCCCGG - Intronic
902501350 1:16913813-16913835 CAGTTGCAAGGCCGCAGCGCAGG - Intronic
902877627 1:19350226-19350248 GAGCTGCGGGGCCTCAGCGCCGG - Intronic
903354737 1:22739762-22739784 CAGCTTCTGGGCTGCTGCGCAGG - Intronic
903698950 1:25232161-25232183 CAGCTCCGCCGCCGCAGCGAGGG + Exonic
903889295 1:26558825-26558847 CAGCTGATGGGCCCCAGCGCTGG - Exonic
906295442 1:44646443-44646465 CAGCTGCTCCGTGTCAGCGCCGG + Intronic
912467136 1:109882044-109882066 CAGCTGCTGCTCCAAAGCTCCGG + Intergenic
913456143 1:119033107-119033129 GAAGTGGTGCGCCGCAGCGCGGG - Exonic
918329496 1:183444428-183444450 CAGCAGCTGCTCTGCAGCGTGGG + Intergenic
920037561 1:203075865-203075887 CAGCTGCAGCGCAGGAGCGCGGG - Intronic
922821364 1:228487751-228487773 CAGCTGCAGCGCGGCCTCGCTGG - Exonic
923810502 1:237309764-237309786 CAGCTGCCTCCCCGCAGGGCAGG - Intronic
924313759 1:242774506-242774528 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1063463560 10:6229341-6229363 CAGCAGGTGAGCCGCAGAGCCGG + Intronic
1064380463 10:14837774-14837796 CAGCTGCTGCGCCGCAGCGCGGG + Intronic
1065099549 10:22320702-22320724 CAGGTTCCGCGCCGCGGCGCCGG + Intronic
1065188871 10:23192964-23192986 CGGCTGCGGCGGCGCGGCGCCGG + Exonic
1065214802 10:23439251-23439273 TTCCTGCTGCGCCACAGCGCAGG - Intergenic
1066575499 10:36820154-36820176 CAGCTGCTTCCCCGCGGGGCAGG + Intergenic
1068352610 10:55868837-55868859 CTGCTACTGCACCGCAGCCCTGG - Intergenic
1069090787 10:64196912-64196934 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1070311388 10:75276253-75276275 CAGCGGCTGCTGCGCGGCGCAGG + Intergenic
1074586048 10:114768357-114768379 CAGCCGCTCTGCCGCGGCGCCGG + Intergenic
1076109522 10:127850172-127850194 CAGCTGCTGGTGCTCAGCGCAGG - Intergenic
1076546187 10:131246922-131246944 AATCTGTTGTGCCGCAGCGCCGG - Intronic
1076546208 10:131247010-131247032 AATCTGTTGTGCCGCAGCGCCGG - Intronic
1076885213 10:133259000-133259022 CAGCTGCTGCACCGCCCTGCAGG - Intergenic
1077208811 11:1358542-1358564 CGGCTGCTGCCCCCCAGCGACGG + Intergenic
1077407617 11:2389638-2389660 CAGCTGCTGAGCGACAGCGCTGG + Intronic
1077610339 11:3639983-3640005 CAGCTGCTGCGAGGCAGTGGGGG - Exonic
1083159950 11:60848668-60848690 CAGCTCCTGCCCCCCAGGGCAGG + Intronic
1083372409 11:62192687-62192709 CAGATGCTGCGCTGGAGGGCTGG + Intronic
1083768252 11:64852578-64852600 CAGCTACTGCCCAGCAGAGCAGG + Exonic
1084313680 11:68331470-68331492 CTGCTGCTCCACCGCAGAGCTGG - Intronic
1085029891 11:73264628-73264650 CAGCTGGTGCTGCGCGGCGCAGG + Intronic
1092346859 12:7722558-7722580 CAGCTGCTGCACTGCAGCCTGGG + Intergenic
1093443751 12:19230495-19230517 CAGCTGCTTCCCCACAGGGCAGG - Intronic
1097938659 12:65279427-65279449 CAGCAGCGGGGCAGCAGCGCAGG - Intronic
1101751254 12:107584392-107584414 CAGCTGCTGTGAGGCAGAGCAGG + Intronic
1101999156 12:109545849-109545871 CAGCTGCTGCTCTGCAGCCTTGG - Intergenic
1103175972 12:118863495-118863517 GAGCTGCTGCAACGCAGCTCAGG - Intergenic
1104841454 12:131828033-131828055 CACCTGCTGCGCTGCGGCGGCGG + Intergenic
1104973877 12:132543442-132543464 CAGCTTCTGGGCCCCAGCCCTGG - Intronic
1106248720 13:27968539-27968561 CAGCTGCTCGGCGGCAGCGGTGG + Exonic
1107285162 13:38782074-38782096 CAGCTCCTGGGGCACAGCGCAGG + Intronic
1110497874 13:76190314-76190336 CAGCTGCCTCCCCGCGGCGCAGG + Intergenic
1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG + Exonic
1115174577 14:30547655-30547677 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1117722057 14:58637967-58637989 CAGCTGCCGGGCCGCGGCGAGGG + Intronic
1118220689 14:63852862-63852884 CTGCTGCTCCGCCCCGGCGCTGG + Intergenic
1119676883 14:76562483-76562505 CTGCTCCTGCGCCCCAGTGCAGG - Intergenic
1120900277 14:89569397-89569419 CAGCTGCAGCTCAGCAGAGCTGG - Intronic
1121030568 14:90654949-90654971 CAGCTGCTGAGCTGCAGGGCTGG - Intronic
1121352599 14:93185161-93185183 CCCCTGCCGCGCTGCAGCGCCGG - Exonic
1121425447 14:93847436-93847458 CAGCTGCTACGTGGCAGAGCTGG + Intergenic
1121690836 14:95876363-95876385 CAGCAGCGGCGCCGCGGGGCGGG + Intergenic
1121828956 14:97033507-97033529 CAGCTGCTGCGCCGCGCCCCGGG - Intergenic
1122294539 14:100697904-100697926 CAGCTGCTGGGGGGCAGGGCTGG + Intergenic
1122582024 14:102777239-102777261 CAACGGCGGCGCCGCGGCGCGGG - Intergenic
1122864984 14:104599657-104599679 CAGCTGCTCCGCCCCAGCCAAGG + Intronic
1123216353 14:106812873-106812895 CAGCGGCTGCTCCGCTGCCCGGG - Intergenic
1125541190 15:40471036-40471058 CCGCTTCGGCGCCGCAGCCCGGG + Exonic
1126569651 15:50136762-50136784 CAGCTGCTGCGTGGCAGAGCTGG - Intronic
1128333680 15:66772752-66772774 CAGCTGCTGAGTGGCAGAGCTGG + Intronic
1129413535 15:75362442-75362464 CAGCTGCTGCGCCTGTGGGCAGG + Exonic
1131250265 15:90825692-90825714 TAGCTGCTTCCCCGCAGGGCAGG + Intergenic
1132301062 15:100775820-100775842 CAGCTGCTCCGTGGCAGAGCGGG + Intergenic
1132950574 16:2560047-2560069 CAGCTGCAGCACCGGAGAGCCGG + Intronic
1132963775 16:2640123-2640145 CAGCTGCAGCACCGGAGAGCCGG - Intergenic
1133814265 16:9184343-9184365 CAGCTGCCTCCCCGCAGAGCAGG - Intergenic
1134172081 16:11976762-11976784 CAGCGGCGGCGGCGCGGCGCAGG + Exonic
1135105474 16:19645677-19645699 CACCTGCTGGGCTGCAGAGCTGG - Intronic
1135607275 16:23835798-23835820 CAGCCGCAGCTCTGCAGCGCCGG - Intergenic
1137396400 16:48118440-48118462 CAGCTGCTGAGCAGCACCACTGG + Intronic
1138552094 16:57753719-57753741 CAGCTGCTGGGCCGCTGCTGGGG - Intronic
1138888449 16:61110197-61110219 CAGCTGCTGCGCCGAGGAGACGG - Intergenic
1140416036 16:74774592-74774614 CAGCTGCTGCGGGCCAGGGCGGG - Exonic
1141175122 16:81713648-81713670 CAGCTGCTGCGGGGCAGAGCAGG - Intergenic
1141407159 16:83804588-83804610 CAGCTGCTGGGCCCCAGGGCTGG + Intergenic
1141695309 16:85616280-85616302 CAGCTCCTGCCCCTCAGCTCGGG - Intronic
1142136178 16:88453025-88453047 CAGGGGCGGGGCCGCAGCGCTGG + Intergenic
1142184072 16:88686188-88686210 CAGCCGCTGCGCAGAGGCGCTGG + Intronic
1142257054 16:89019078-89019100 CAGCTGCTACCCCACAGAGCAGG + Intergenic
1142395347 16:89828565-89828587 CAGCTGCGGCGGCGCCGCGGCGG + Exonic
1142411564 16:89919581-89919603 CTGCTGCAGCACCGCAGCCCGGG - Exonic
1142955498 17:3518770-3518792 CAGCTTCAGCGACGCAGTGCTGG - Exonic
1143684950 17:8506299-8506321 CAGCTGCTGGGCTGCAGACCTGG + Exonic
1144339742 17:14301674-14301696 CGGCTCCTGCGCCGCCGCGCCGG + Exonic
1145031529 17:19507986-19508008 CCGCTGCGGCGCCGCAGTTCAGG + Intronic
1145128395 17:20320544-20320566 CAGCGGCTGCGGCACAGGGCGGG + Intergenic
1145196217 17:20896670-20896692 CAGCGGCTGCGGCACAGGGCGGG - Intergenic
1146142435 17:30379336-30379358 CAGCAGCGGCCCCGCAGCGTCGG - Exonic
1146952260 17:36915010-36915032 CAGCTGCTGAGAGGCAGCACTGG - Intergenic
1148178397 17:45586252-45586274 CTGCTTCTGTGCCGCAGCACCGG + Intergenic
1149626522 17:58083936-58083958 CAGCGGCAGCTCCGCAGCCCGGG - Intronic
1150624895 17:66835321-66835343 CCGGTGCTGGGCCGCGGCGCCGG + Intronic
1152103019 17:78313987-78314009 CAGCCGCTGCGGCGCGGCCCCGG + Intergenic
1152685167 17:81690370-81690392 CAGCTGCTACGCCTCCGCCCAGG - Intronic
1155611686 18:27674002-27674024 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1156683587 18:39618678-39618700 CAGCTGCTTCCCTGCAGGGCAGG + Intergenic
1162913362 19:13861861-13861883 CTGCTGCTGTGTCGCAGCCCTGG + Intergenic
1162959478 19:14117574-14117596 CACCCGCCGCGCCGCAGCTCCGG - Exonic
1163372927 19:16912308-16912330 CAACTGCTGCCCTGCAGGGCAGG + Intronic
1163563994 19:18038861-18038883 CTGCTGCTGCCTCGCTGCGCTGG - Intergenic
1164047855 19:21558190-21558212 CAGCTGCTGCCCCTGAGCTCAGG + Intergenic
1165139594 19:33690711-33690733 CAGCAGGTGCGCAGCAGAGCCGG + Intronic
1166100361 19:40567985-40568007 CACCTGCTCCGCCGCCGCGGGGG - Exonic
1167042742 19:47032285-47032307 CCGCCGCGGCCCCGCAGCGCTGG + Exonic
1167418812 19:49390855-49390877 CAGCAGCTGCGCCGCGGCAGGGG + Exonic
1168339532 19:55615197-55615219 CCGCTGCTGCTCGGCGGCGCGGG + Exonic
1168640011 19:58024880-58024902 CAGCTTCAGCGCCCCAGTGCTGG + Intergenic
925558882 2:5166169-5166191 CAGCTTCTGGGCCACAGGGCTGG + Intergenic
926172141 2:10559142-10559164 CAGCTGCTGCGCGGTGGGGCTGG + Intergenic
926251094 2:11155789-11155811 CAGCTGCGACGCCGGCGCGCGGG - Intronic
928694608 2:33836587-33836609 CAGCTGCTGGTCCACAGGGCAGG + Intergenic
931106992 2:59067151-59067173 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
932334574 2:70922694-70922716 CAGCTGCTGTCCTGCAGGGCCGG + Intronic
933269451 2:80217375-80217397 CAGCTGCTGAGTAGCAGAGCTGG - Intronic
934763823 2:96869648-96869670 CACCTGCAGCCCCGCAGCCCCGG - Intronic
935878343 2:107536228-107536250 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
937313394 2:120915856-120915878 CAGCTGCTGCTCAGAAGCACTGG + Intronic
937600736 2:123728501-123728523 CAGCTGCTGTGAAGCAGAGCAGG + Intergenic
938265107 2:129922963-129922985 CAGCTGCTGGGCTCCAGCTCCGG + Intergenic
938728774 2:134130070-134130092 CAGCAGCTGCGGAGGAGCGCCGG + Intronic
943665707 2:190606308-190606330 CAGCTAGTGTGCCGCAGAGCTGG - Intergenic
947539338 2:230964374-230964396 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1168887005 20:1266793-1266815 CACCTGCCGCGGTGCAGCGCAGG - Intronic
1169207858 20:3750010-3750032 CAGCTGCTGTGCCGCATCTTCGG + Exonic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171879892 20:30610907-30610929 AAGCAGCTGCGCTGCAGAGCTGG + Intergenic
1175962406 20:62643597-62643619 CAGCTGCTGCTCCTCAGCTGTGG + Intronic
1176170504 20:63694405-63694427 CAGCTGCTGGGCTGCAGCCGTGG - Exonic
1179173702 21:38992170-38992192 CAGCTGCTGCGGCTCACCTCTGG - Intergenic
1179605708 21:42513996-42514018 CGGCTGCGGCGCCTGAGCGCCGG - Exonic
1180877912 22:19183668-19183690 CAGCAGCTGGGCCGGAGGGCAGG + Intronic
1183270749 22:36861170-36861192 CAGCTGCTGGGCCACAGCCATGG - Exonic
1183437014 22:37802312-37802334 CAGCTGCTGTGCCGTGGCGCGGG - Intergenic
1183563612 22:38596501-38596523 GAGCTGCTGCACTGCAGCCCGGG + Intronic
1183686381 22:39363500-39363522 CAGCTGCTGGGCCCCAGTCCTGG - Intronic
1183961618 22:41414670-41414692 CAGCTGCTGAGCCACAGGGCAGG - Intergenic
1184316753 22:43699289-43699311 AAGCTGCTGCCCAGCAGGGCAGG - Intronic
1184409263 22:44317269-44317291 CAGCTGCTGCACCGACGAGCAGG + Intergenic
1184841063 22:47052647-47052669 CAGCCGCTGCCCCTCAGAGCAGG - Intronic
950104064 3:10377276-10377298 CAGCTGCGGAGCCTCAGAGCCGG + Intronic
952383022 3:32818820-32818842 GAGCTGCTGCGCCGCTGCTGCGG - Exonic
952383024 3:32818823-32818845 CAGCAGCGGCGCAGCAGCTCGGG + Exonic
953980611 3:47411125-47411147 CAGCTGCGGCGCCTCGGCGCAGG - Exonic
954385087 3:50239878-50239900 CAGGGGCTGCTCCGCAGCCCTGG + Intronic
954468836 3:50674812-50674834 CCGCTGCTGCGCGCCAGCGGAGG - Intergenic
954558818 3:51538896-51538918 CACCTCCTGCGCCGCGGCTCCGG - Intergenic
958470202 3:94507628-94507650 CCGCGGCAGAGCCGCAGCGCCGG + Intergenic
959462480 3:106643993-106644015 CAGCTGCTGCCTCGCGGGGCAGG + Intergenic
959920215 3:111860453-111860475 CAGCTGCGCCTCCGCCGCGCAGG - Intronic
964064082 3:152559658-152559680 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
968440991 4:624360-624382 CAGCTGCAGCGGTGCAGCCCAGG + Intergenic
969235813 4:5864554-5864576 CAGGTGCTGGGCCCCAGGGCGGG + Intronic
974807546 4:66899596-66899618 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
977607211 4:98995527-98995549 CAGCTGGTGCCCCGCCCCGCCGG - Intergenic
978515142 4:109560797-109560819 AAGCCGCTGCGCCGCGGGGCCGG + Intronic
978748586 4:112222656-112222678 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
978761509 4:112359113-112359135 CAGCTGCTGGGCCACAGCCTTGG - Intronic
979582787 4:122379621-122379643 CTGCTGCTGCGCCTCAGGCCGGG - Intronic
982985785 4:162203811-162203833 CAGCTGCCCCGCCGCGGGGCAGG + Intergenic
984871309 4:184327671-184327693 CAGCTGCTAAGCAGCAGAGCTGG - Intergenic
984918125 4:184741430-184741452 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
985269325 4:188179185-188179207 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
985629044 5:1005363-1005385 CAGCGGCTGCAGCGCAGCTCGGG - Intergenic
986152507 5:5140340-5140362 CAGCGACTCCGCCGCCGCGCCGG - Exonic
987085152 5:14461153-14461175 CCGCTGCTGAGCCGCCGCACGGG - Exonic
987441874 5:17966910-17966932 CAGCTGCAGCCTCGCAGAGCCGG - Intergenic
990954980 5:61332111-61332133 CAGCTTCTGCGTCACAGCGGAGG + Intergenic
992042367 5:72848539-72848561 CGGGGGCTGGGCCGCAGCGCGGG - Intronic
997375526 5:133394576-133394598 CAGCTGCCTCCCCGCAGGGCAGG + Intronic
997868331 5:137484346-137484368 CAGCTTCTGCTCCCCAGCTCTGG + Intronic
999300202 5:150486154-150486176 GAGCTGCCCCGGCGCAGCGCCGG + Intronic
1001529998 5:172454702-172454724 CCGGTGCTGAGCCGCCGCGCCGG + Intergenic
1004193920 6:13487485-13487507 CCGCTGCCGCGCTGCAGCTCGGG - Exonic
1004193923 6:13487488-13487510 GAGCTGCAGCGCGGCAGCGGCGG + Exonic
1010141748 6:72621594-72621616 CCGCTGCTACGTCGCTGCGCCGG - Intergenic
1015127124 6:129767450-129767472 CAGCTGCAGCGGCGCAGCAGCGG - Intergenic
1017446360 6:154510368-154510390 CAGCTGCTGCTCCCGAGCGACGG + Exonic
1017796664 6:157850833-157850855 CAGCTGGTGCACCCCAGCACAGG - Intronic
1018531208 6:164765310-164765332 CTGCTGCCGCTCCGCAGCGGTGG - Intergenic
1018674073 6:166203798-166203820 CGGCTGCTGCGGGGCAGGGCTGG + Intergenic
1019292253 7:256512-256534 CAGCCTCAGCGCCGCAGCCCGGG + Intronic
1019379389 7:712983-713005 AAGCTGGTGCGCCTAAGCGCTGG - Intronic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1019414305 7:920358-920380 CAGCTGATGCCCCACAGGGCTGG + Intronic
1021133893 7:16943213-16943235 CAGCTGCTTCCCTGCAGGGCAGG + Intergenic
1022099504 7:27160872-27160894 CAGCTGCAGCCCGGCAGCACTGG + Intergenic
1022266558 7:28761276-28761298 CAGCTGCTGCTCACCAGCGATGG + Intronic
1028641137 7:93043491-93043513 CAGCTGCCGCAGCCCAGCGCCGG + Intergenic
1029813986 7:103075243-103075265 CCGCGGCAGAGCCGCAGCGCCGG - Exonic
1033072575 7:138217784-138217806 CAGCTGCTGAGCCACAGCATTGG + Intergenic
1035266030 7:157690775-157690797 CAGCGGCTGCGCGGCGGCACGGG + Intronic
1035463879 7:159063275-159063297 CAGCTGCCTCCCCGCAGGGCAGG - Intronic
1035782519 8:2239667-2239689 CAGCTGCTGTGCCCCAGAGAGGG - Intergenic
1035809601 8:2479921-2479943 CAGCTGCTGTGCCCCAGAGAGGG + Intergenic
1036135078 8:6152931-6152953 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1037947798 8:22999969-22999991 CAGCAGCAGCGCGGCGGCGCCGG + Intronic
1040794194 8:51271463-51271485 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1040954018 8:52961592-52961614 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1042948740 8:74179666-74179688 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1044459632 8:92429368-92429390 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1046661184 8:116949890-116949912 CAGCTGCCTCCCCGCGGCGCAGG - Intergenic
1048112872 8:131487253-131487275 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1049219906 8:141424432-141424454 CAGCTGGGGCGCCTCAGAGCAGG - Intronic
1053643123 9:40106765-40106787 CGGCGGCTGCGGCGCAGCCCGGG + Intergenic
1053763027 9:41358724-41358746 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1054541633 9:66269838-66269860 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1057772797 9:97983253-97983275 CAGCTGCCGCGCCGCGTCGCCGG + Intergenic
1058051574 9:100411735-100411757 CAGCTCCAGCGCAGCAGCTCTGG + Intergenic
1058552644 9:106132036-106132058 CAGCTGATGGGCAGCAGAGCAGG + Intergenic
1058885781 9:109320501-109320523 CTGCCGCTGCGCCGCCGCCCGGG + Exonic
1059021307 9:110579557-110579579 GAGCGGCTGCCCCGGAGCGCAGG + Exonic
1060478308 9:124000967-124000989 CAGCTGCCCAGCCGCAGCCCAGG + Intergenic
1060687621 9:125625440-125625462 CAGCTGCTGCTCTGCAGGGTTGG - Intronic
1061586915 9:131575460-131575482 CAGCTGCTGCCCCGCAGCCCTGG + Intergenic
1062265218 9:135683769-135683791 CAGCTGCTCCCCCTCAGGGCTGG - Intergenic
1062328549 9:136024840-136024862 CAGCTGCTCCACCCCAGGGCTGG - Intronic
1185465183 X:350379-350401 CCGCTGCACCGCCCCAGCGCAGG + Intronic
1185736625 X:2500834-2500856 CAGCTGCTGCGGCGCTGCCGCGG - Exonic
1192232941 X:69278361-69278383 CAGCTGCTGAGTCCCAGCCCCGG + Intergenic
1195802806 X:108732894-108732916 CGGCTGCTGCGCCGATGCCCGGG + Exonic
1198767084 X:140091310-140091332 GAGCTGCGGGGCCGCAGCGGCGG + Intergenic