ID: 1064381222

View in Genome Browser
Species Human (GRCh38)
Location 10:14843411-14843433
Sequence GAGCAACTGCACCTCTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 202}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064381222_1064381233 19 Left 1064381222 10:14843411-14843433 CCTTTTCAGAGGTGCAGTTGCTC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1064381233 10:14843453-14843475 GGCCAGACTGGGTGTGTCCGGGG 0: 1
1: 0
2: 1
3: 10
4: 155
1064381222_1064381232 18 Left 1064381222 10:14843411-14843433 CCTTTTCAGAGGTGCAGTTGCTC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1064381232 10:14843452-14843474 TGGCCAGACTGGGTGTGTCCGGG 0: 1
1: 0
2: 2
3: 16
4: 275
1064381222_1064381231 17 Left 1064381222 10:14843411-14843433 CCTTTTCAGAGGTGCAGTTGCTC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1064381231 10:14843451-14843473 ATGGCCAGACTGGGTGTGTCCGG 0: 1
1: 0
2: 0
3: 26
4: 162
1064381222_1064381227 8 Left 1064381222 10:14843411-14843433 CCTTTTCAGAGGTGCAGTTGCTC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1064381227 10:14843442-14843464 AGCAGCCCCATGGCCAGACTGGG 0: 1
1: 0
2: 2
3: 30
4: 226
1064381222_1064381223 -2 Left 1064381222 10:14843411-14843433 CCTTTTCAGAGGTGCAGTTGCTC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1064381223 10:14843432-14843454 TCCCTGTCAGAGCAGCCCCATGG 0: 1
1: 1
2: 1
3: 27
4: 282
1064381222_1064381226 7 Left 1064381222 10:14843411-14843433 CCTTTTCAGAGGTGCAGTTGCTC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1064381226 10:14843441-14843463 GAGCAGCCCCATGGCCAGACTGG 0: 1
1: 0
2: 2
3: 26
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064381222 Original CRISPR GAGCAACTGCACCTCTGAAA AGG (reversed) Intronic
900840167 1:5042321-5042343 GAGCAAATGGACCTCTTACATGG + Intergenic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
902881031 1:19371916-19371938 GAACAACTGCAGTTCTGAAATGG + Intronic
903221137 1:21870282-21870304 CCGCAACTGCTCCTCTGAGAGGG + Intronic
903455857 1:23486206-23486228 GAGGAAGTGCATCTCAGAAAGGG - Intergenic
905479341 1:38250352-38250374 GAGCCACAACACCCCTGAAATGG - Intergenic
907077095 1:51588778-51588800 GAGCATTTGGATCTCTGAAAAGG + Intronic
907105048 1:51875279-51875301 GAAGAACTGCTCTTCTGAAAGGG + Intronic
907974909 1:59422283-59422305 GAGCAACTGAATCTATTAAAAGG - Intronic
916434399 1:164763783-164763805 AAGCAACAGCAACACTGAAAAGG + Intronic
917976504 1:180243271-180243293 GAGCCACTGTACCTCTGTAAGGG + Intronic
919047844 1:192475913-192475935 GAACAATTGCATCTCAGAAAAGG + Intergenic
920080679 1:203370782-203370804 TAGCACCTGCACATCAGAAATGG + Intergenic
1063126020 10:3137361-3137383 GAACAGCTGCGCCTCAGAAATGG + Intronic
1064086879 10:12351627-12351649 GTGCAGCTGCACCTCTGCAGTGG + Intronic
1064344884 10:14522923-14522945 AATCAACTACACATCTGAAAGGG - Intronic
1064381222 10:14843411-14843433 GAGCAACTGCACCTCTGAAAAGG - Intronic
1065781530 10:29173116-29173138 GAGCAAATGCACATCTTACATGG + Intergenic
1070617046 10:77977311-77977333 GAGCAGCTTCTCCTCTGATAGGG - Exonic
1071221830 10:83476233-83476255 CAGCACCTGCACCACAGAAATGG - Intergenic
1072082638 10:92046442-92046464 ACCCAACTGCACCTCTAAAAAGG + Intergenic
1076155834 10:128205027-128205049 GAGCCACTGCACCTCTGCCTGGG - Intergenic
1077436778 11:2543885-2543907 GATAAACTGAACCTCTTAAAAGG - Intronic
1078078521 11:8184347-8184369 GAGCAACTGGAACTCTCAGATGG - Intergenic
1078659281 11:13273744-13273766 GAGCTAATGCATTTCTGAAATGG + Intergenic
1079144246 11:17836735-17836757 GAGAAACTGCACCTCAGAAGGGG - Intronic
1079538754 11:21546617-21546639 GAGCAAAGGCACCTCTTACATGG - Intronic
1082765305 11:57163087-57163109 CAGCATCTTCACCTGTGAAATGG - Intergenic
1086101797 11:83108222-83108244 GAGCCACTGCACCTGTCCAAGGG + Intergenic
1086243079 11:84720033-84720055 GAGCAGATGCAGCTCGGAAATGG - Intronic
1086543910 11:87945984-87946006 CAGCTTCTGCATCTCTGAAAAGG - Intergenic
1088595418 11:111437147-111437169 GAACATCTGCTCCTCTGACAGGG + Intronic
1090522540 11:127494885-127494907 GAACCACTGCACCCCTGAAGTGG + Intergenic
1096872103 12:54599463-54599485 GACCACCTGAACCTCTGCAATGG - Intergenic
1099015154 12:77335739-77335761 GAGCAACTGCTCCTTTGAAGAGG + Intergenic
1100984232 12:100189443-100189465 GAGCAACTCTGCCCCTGAAAGGG + Intergenic
1102211084 12:111127816-111127838 GAGCAAATGCACGTCTTACATGG + Intronic
1103407220 12:120684816-120684838 GAGCAGCTGGATCTCAGAAAGGG + Intergenic
1105768138 13:23580551-23580573 GTGAAACTGCACCACAGAAAAGG - Intronic
1107172393 13:37358441-37358463 TAGCAACTGTAACTTTGAAATGG + Intergenic
1107955651 13:45508746-45508768 GAGCAAAGACACCTCTGTAAGGG - Intronic
1108977681 13:56469125-56469147 GTGCAACTGTACTTTTGAAATGG + Intergenic
1109098037 13:58142780-58142802 GAGCAAATGCACGTCTTACATGG - Intergenic
1109391695 13:61703336-61703358 GAGCAACGGCACATCTTACATGG - Intergenic
1109999660 13:70178972-70178994 GGACAACTTAACCTCTGAAATGG + Intergenic
1113384303 13:109834076-109834098 CAGCAACTGCTCCTCTTAAGTGG + Intergenic
1113412876 13:110105789-110105811 CACCCACTGCACCTCTAAAATGG - Intergenic
1114191503 14:20442762-20442784 GAGCAACTGCTCAGCTGGAAAGG + Intergenic
1115161588 14:30402471-30402493 GAAAAACTGAACTTCTGAAAGGG - Intergenic
1115535303 14:34367224-34367246 GAGCAACTGTACCTTTGAAATGG + Intronic
1115854937 14:37621249-37621271 GAGAAACTGCAAATCTGAATTGG + Intronic
1119434486 14:74589052-74589074 GAGAAACTGCACATCTCAATTGG + Intronic
1120481622 14:85055961-85055983 GATAAACAACACCTCTGAAATGG - Intergenic
1121917819 14:97852106-97852128 TAGGAACTGCCCCTCTCAAAAGG - Intergenic
1122166904 14:99832483-99832505 CAGCAATTGCATCTCTGACATGG - Intronic
1123041805 14:105493294-105493316 GAGCAACAGACCCTCTGCAAGGG - Intronic
1129270823 15:74418429-74418451 GAGCAACTGGGGCTCTGAGAGGG + Intronic
1130662605 15:85842592-85842614 GAGCACATGCACCTATAAAATGG - Intergenic
1133416206 16:5609062-5609084 GAGCAAATACATCTCTGTAAGGG + Intergenic
1134827167 16:17294122-17294144 AAGCAACTGTTCCTCTGAAGGGG + Intronic
1135828065 16:25747939-25747961 TGGCAATTGCACCTGTGAAAGGG + Intronic
1136724243 16:32344840-32344862 GAGTCACTGCACCTATAAAAGGG - Intergenic
1137722802 16:50637762-50637784 TGGCAACTGCTCCTCTGGAATGG - Exonic
1140830935 16:78750255-78750277 GAGAAACTGAGCCTCTGAATAGG - Intronic
1203002189 16_KI270728v1_random:172925-172947 GAGTCACTGCACCTATAAAAGGG + Intergenic
1203133792 16_KI270728v1_random:1709332-1709354 GAGTCACTGCACCTATAAAAGGG + Intergenic
1143208674 17:5166507-5166529 GAGGAAGTTCACCTCTGGAAGGG + Intronic
1144617999 17:16794618-16794640 GAGGAAGTTCACCTCTGGAAGGG + Intronic
1144894706 17:18521078-18521100 GAGGAAGTTCACCTCTGGAAGGG - Intergenic
1145137518 17:20423166-20423188 GAGGAAGTTCACCTCTGGAAGGG + Intergenic
1146313759 17:31791266-31791288 CAGCATATGCCCCTCTGAAAAGG + Intergenic
1147448916 17:40491735-40491757 CAGCGACTGCACCCCTGCAATGG - Intronic
1148408458 17:47442753-47442775 GAGCAAATTCACCTCTTACATGG + Intergenic
1149871614 17:60187059-60187081 GAGGAAGTTCACCTCTGGAAGGG - Intronic
1149998574 17:61417671-61417693 GGACAACTGCGCCTCTGCAATGG - Intergenic
1150125916 17:62634784-62634806 GAGCAACTCCATCTTTAAAAGGG - Intronic
1156282080 18:35649181-35649203 GAGCAACTGGAACTCTAATACGG - Intronic
1157578920 18:48762088-48762110 GATCAACTGCATATCTGCAAAGG - Intronic
1161234459 19:3190944-3190966 GAGCACCGGCCCCTCTAAAAGGG - Intronic
1163173589 19:15549541-15549563 GAGCCACTGCACCTGTAAACCGG - Intronic
1167179430 19:47891210-47891232 GAACAATTTCACCTCTGGAAAGG + Intergenic
924965918 2:76477-76499 GAGCAAAGGCACCTCTTACATGG + Intergenic
925058597 2:873922-873944 GAGCTACAGCAGCTCGGAAAAGG - Intergenic
925261465 2:2531971-2531993 GAGCAAAGGCACCTCTTACATGG - Intergenic
925580368 2:5404316-5404338 GAGCAAAGGCACCTCTTACACGG + Intergenic
928388403 2:30889089-30889111 AATCATCTGCAACTCTGAAAAGG - Intergenic
929289545 2:40173512-40173534 GAGCAACAGCCCATGTGAAACGG + Intronic
930050898 2:47215551-47215573 CAGCAACTGGATCTCTGAGAGGG + Intergenic
930247257 2:48997178-48997200 GAGAAACTGAGACTCTGAAAAGG - Intronic
930403381 2:50921453-50921475 AAGCATGTGCACCACTGAAATGG - Intronic
931329740 2:61268036-61268058 GAGCCACTGCACCTGGCAAAGGG + Intronic
931748365 2:65309994-65310016 GAGCAACTGAAGCTTAGAAAGGG - Intergenic
931871259 2:66462598-66462620 GTACAACTGCAGCTCTAAAAGGG - Intronic
933948485 2:87308584-87308606 GAGCAGCAGAACCTCTGGAAAGG - Intergenic
935261733 2:101361795-101361817 TGGCAGCTGCACCCCTGAAATGG + Intronic
935672095 2:105564648-105564670 TAGCATCTGCACATCAGAAAGGG - Intergenic
936331714 2:111553011-111553033 GAGCAGCAGAACCTCTGGAAAGG + Intergenic
936874068 2:117167295-117167317 GAGCAAAGGCACCTCTTACATGG - Intergenic
937691997 2:124767149-124767171 GAGCCACTGCATCTGTTAAAAGG - Intronic
939416127 2:141899776-141899798 GTGACACTGCACCTCAGAAATGG + Intronic
939780929 2:146446603-146446625 GAGCAAATGCACATCTTACATGG + Intergenic
941234532 2:162953617-162953639 GAGCAACTCCACCTCTGCACTGG + Intergenic
944665270 2:201954219-201954241 GGGCAGCTGCTCCTCTGAGAAGG - Intergenic
945716711 2:213366498-213366520 GAGCAAAGGCACCTCTTAGATGG + Intronic
946139740 2:217680077-217680099 GAGCAACTGAATATCTGTAAGGG - Intronic
946163700 2:217850987-217851009 GAGAAACTGAGCCTCTGAGAGGG + Intronic
946356647 2:219190248-219190270 GAGCCACTGCACCTGTGATATGG + Intergenic
947537932 2:230952698-230952720 GGGCATCTGCACAGCTGAAATGG + Intronic
1170145835 20:13173525-13173547 CAGCAAAGGCACCTTTGAAATGG + Intergenic
1170516029 20:17131205-17131227 GAACAACTGCTCCTTTGGAATGG - Intergenic
1170829741 20:19829824-19829846 GAGCAACTCCAGCTCTGCCATGG + Intergenic
1171093753 20:22311581-22311603 GTGTCACTGCACCTCTGGAATGG - Intergenic
1172478962 20:35259804-35259826 GAGCACCAGCACCCCTGATAGGG - Intronic
1172883119 20:38214358-38214380 GAGGAATTTCACCTCTCAAAAGG - Intronic
1175904496 20:62372731-62372753 GAACACCTGCAGCTCTGCAAAGG + Intergenic
1178122328 21:29481792-29481814 GAGCAACTGCAGTTATAAAAAGG - Intronic
1179445724 21:41428910-41428932 GAGCAACTGCCCCTGTGCAGGGG - Intronic
1179501928 21:41815528-41815550 GAGCAGCTGCATATCTCAAAAGG - Intronic
1182623993 22:31632716-31632738 GACCACCTGCAACCCTGAAATGG + Intronic
956600698 3:71019056-71019078 CACCAGCTGCACCTCTGAATGGG + Intronic
959824001 3:110771175-110771197 CAGTAACTGCTCCTCAGAAAAGG + Intergenic
960823742 3:121760877-121760899 AATCACCTGCACCTCAGAAATGG - Intergenic
962324755 3:134423706-134423728 GAGCCAGTTCACTTCTGAAATGG + Intergenic
962514662 3:136139280-136139302 CAGAAACTGCTCATCTGAAAGGG + Intronic
963068181 3:141280415-141280437 TAGGAACTGAACCTCTCAAATGG - Intronic
968383495 4:114823-114845 GAGCAACTCCATCTCGAAAAGGG + Intergenic
968907294 4:3460403-3460425 GAGCAAAGGCACCTCTTACATGG + Intergenic
976836493 4:89380538-89380560 GAGCAAATGCACATCTTACATGG + Intergenic
977524997 4:98133363-98133385 GAACAACTGGACATGTGAAAAGG - Intronic
977707708 4:100089622-100089644 GAGCCACTGCACCTGGCAAAGGG + Intergenic
978964145 4:114721878-114721900 CAGTAACTGCACCTCTGCACTGG - Intergenic
979108535 4:116719301-116719323 GAGCAAGTTCACATCTTAAATGG + Intergenic
980738636 4:136922194-136922216 GGGAAACTGCACCATTGAAATGG + Intergenic
981573573 4:146178867-146178889 GGGCAGCTGTACCTGTGAAAGGG + Intronic
981821917 4:148897175-148897197 GAGCAAATGCACATCTTACATGG + Intergenic
982232894 4:153225008-153225030 GAGTAACTGCTGCTCAGAAAAGG - Intronic
985375795 4:189337190-189337212 GAGCAAAAGCAATTCTGAAAGGG - Intergenic
985391809 4:189498138-189498160 TAGCAAGTGCAGCTCTGCAATGG + Intergenic
986461052 5:7972609-7972631 GAGCACTTTCACCTTTGAAAAGG + Intergenic
986549558 5:8937485-8937507 TAGCATCTGCTTCTCTGAAAAGG - Intergenic
987359164 5:17091311-17091333 GAGCAACTGATGCTCTGAAACGG - Intronic
991363504 5:65844714-65844736 GAGCAACTCCATCTTGGAAAGGG - Intronic
992458820 5:76941450-76941472 GAGCAAAGGCACCTCTTACATGG - Intergenic
994191180 5:96870955-96870977 CAGAAACTGAACCACTGAAAAGG - Intronic
997564275 5:134874988-134875010 GAGCATCTTCATCTGTGAAATGG - Intronic
998707063 5:144774733-144774755 GAGCAAAAGCATTTCTGAAAAGG - Intergenic
999099732 5:149013331-149013353 GAGCAAAGGCACATCTTAAATGG - Intronic
999288943 5:150410956-150410978 CACAAAATGCACCTCTGAAAGGG + Intronic
999421517 5:151448344-151448366 GGGAAACTTCACCTGTGAAAAGG + Intronic
1000358775 5:160427880-160427902 GAGCAAGTGCCCTTCTGGAAGGG + Intronic
1000511003 5:162182975-162182997 GAGCAAAGGCACGTCTGACATGG - Intergenic
1000768454 5:165320089-165320111 GAGCAAAGGCACATCTTAAATGG + Intergenic
1003668172 6:8130979-8131001 GAGCTCCAGCAGCTCTGAAATGG + Intergenic
1004844883 6:19629812-19629834 GAGCAACTGAAACTCTCACAGGG + Intergenic
1004917930 6:20349226-20349248 GATAAACAGCACCACTGAAAGGG + Intergenic
1005403625 6:25461795-25461817 GAGCAACTGGAACTCTCAAATGG - Intronic
1008282403 6:49612229-49612251 GAACCACTGAACCACTGAAATGG + Intronic
1009230923 6:61060078-61060100 GAGCAACTGCTCTGCTGAGAAGG + Intergenic
1012297660 6:97545469-97545491 GAGCAACAGCACATCTTACATGG + Intergenic
1012379371 6:98601832-98601854 GAGCCACTTCACCTCTGAACAGG - Intergenic
1014407667 6:121070402-121070424 GAGCAAATGCACATCTTACATGG - Intergenic
1016779224 6:147939754-147939776 GAACAACTGTGCCTCTGGAAAGG - Intergenic
1018574623 6:165246488-165246510 GAGCCAATGCACATATGAAATGG - Intergenic
1019117239 6:169774892-169774914 AGGCACCTGCACCTCTGACATGG + Intronic
1023136395 7:37056873-37056895 CAGTTACTGCACCTCTGAATAGG + Intronic
1023194843 7:37623721-37623743 GAGCCACTGCTCCTCTGACCTGG - Intergenic
1023684033 7:42716996-42717018 GAATAACCCCACCTCTGAAAAGG + Intergenic
1024247089 7:47479013-47479035 TAGCAACCACACCTGTGAAAAGG + Intronic
1024468717 7:49742991-49743013 GACCCACTGCAGCTATGAAAAGG + Intergenic
1027636075 7:80676260-80676282 AAGCAACTGCACATTTCAAAAGG + Intronic
1027705057 7:81520041-81520063 TAGAAACAGCACCTCAGAAATGG - Intergenic
1030699681 7:112624005-112624027 GAGCAACTCCATCTCTAATAGGG - Intergenic
1031715813 7:125108005-125108027 GAGCAAAGGCACATCTTAAATGG + Intergenic
1032471204 7:132180625-132180647 GAGCAGCTGGACATCTGACACGG + Exonic
1032594249 7:133223665-133223687 GAGCAAAGGCACCTCTTACATGG + Intergenic
1032871781 7:135993721-135993743 GAGCAACTGCAGTGCTAAAATGG + Intergenic
1032876499 7:136044128-136044150 GAGCAAATGCACATCTTACATGG - Intergenic
1032916195 7:136492816-136492838 GAGCAACAGCCTCTTTGAAAGGG - Intergenic
1033048885 7:137986417-137986439 GAGCGACTGCACCCCTGAGATGG + Intronic
1033773333 7:144578529-144578551 GAGCAAAAGCACATCTGACATGG - Intronic
1034850257 7:154486806-154486828 GACCTACAGCACCTCTGGAAGGG - Intronic
1035087833 7:156276469-156276491 GAGTATTTGCATCTCTGAAAGGG + Intergenic
1037276269 8:17183152-17183174 AAGCACCAGCACCTCTGGAATGG + Intronic
1037790811 8:21940022-21940044 GATCAACTTCACATTTGAAAAGG - Intronic
1038049006 8:23791595-23791617 AAGAAACTGCAGCTCAGAAAAGG + Intergenic
1038821591 8:30957123-30957145 GAGGAACTGGACCTCAGAACTGG + Intergenic
1042096533 8:65222108-65222130 GAGAAACTGCACCTCTCCATTGG + Intergenic
1042385838 8:68173271-68173293 CAGCATCTGCACCTTTCAAATGG - Intronic
1042500556 8:69504080-69504102 GAGCCACTGCGCCCATGAAAAGG + Intronic
1048153318 8:131915611-131915633 GAGAGACTGCACCTCTGATTGGG + Intronic
1048565013 8:135586637-135586659 CAACATCTGTACCTCTGAAAAGG + Intronic
1050095863 9:2065201-2065223 TGGAAACTGAACCTCTGAAATGG - Intronic
1050614081 9:7383402-7383424 TAGCATCTTCACCTCTAAAATGG - Intergenic
1052088076 9:24292113-24292135 GAGCAAAGGCACCTCTTACATGG + Intergenic
1052689852 9:31802927-31802949 GAGCAAAGGCACGTCTTAAATGG - Intergenic
1056184552 9:84120826-84120848 GAGAATCTGCTACTCTGAAATGG - Intergenic
1056893842 9:90522486-90522508 GCGTAACTTCATCTCTGAAAAGG + Intergenic
1057024989 9:91727957-91727979 TAGCAGCTTCCCCTCTGAAAGGG + Intronic
1058003395 9:99890224-99890246 GAGCAACTACATCTTTTAAAAGG + Intergenic
1062168951 9:135123748-135123770 GAGCACCTGCAGCTCTGACAGGG - Intergenic
1185971339 X:4668289-4668311 GAGCAAAGGCACCTCTTACATGG + Intergenic
1186465942 X:9785219-9785241 CAGCATCGTCACCTCTGAAAAGG + Intronic
1187929165 X:24278200-24278222 GAGCAAAGGCACCTCTTACATGG + Intergenic
1188297205 X:28463806-28463828 GAGCAAAGGCACATCTTAAATGG + Intergenic
1189959598 X:46311802-46311824 GGGCAACTGCAACTGTGAAATGG - Intergenic
1189993592 X:46617767-46617789 GAGAAACTGATCCTCTGAAGAGG - Intronic
1192842080 X:74866780-74866802 GAGCAAAGGCACATCTGACATGG - Intronic
1193387199 X:80885719-80885741 GAGCAAATGCACGTCTTACATGG - Intergenic
1194745935 X:97628315-97628337 GAGCAAAGGCACATCTGACATGG - Intergenic
1196033165 X:111113516-111113538 GAGCTACAGCACTTCAGAAAAGG - Intronic
1198721627 X:139627783-139627805 CAGAAACTGCAACTCAGAAAAGG + Intronic
1198835773 X:140803357-140803379 TGGCAACTGTACCCCTGAAAGGG - Intergenic
1198849306 X:140948776-140948798 TAACAACTGCACCTTTGAAATGG + Intergenic
1199056907 X:143307426-143307448 GATCATCTGCACACCTGAAAGGG - Intergenic
1199186495 X:144921449-144921471 GAGCAAAAGCACATCTGAAACGG - Intergenic
1199615045 X:149649467-149649489 GGGCAACTGCACCCCTGAAGAGG - Intergenic
1199689673 X:150298911-150298933 GAGACACAGCCCCTCTGAAAGGG + Intergenic
1201675256 Y:16574542-16574564 GTGCAGCTGCATCTCCGAAATGG - Intergenic
1202195840 Y:22297725-22297747 GAGCACCTGCAGCACTGGAATGG - Intergenic