ID: 1064385477

View in Genome Browser
Species Human (GRCh38)
Location 10:14887323-14887345
Sequence AACCTGTATTTTCCTAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064385477_1064385480 -6 Left 1064385477 10:14887323-14887345 CCAGGTCTAGGAAAATACAGGTT 0: 1
1: 0
2: 0
3: 16
4: 280
Right 1064385480 10:14887340-14887362 CAGGTTTCTGACTTGGGCAGTGG No data
1064385477_1064385481 20 Left 1064385477 10:14887323-14887345 CCAGGTCTAGGAAAATACAGGTT 0: 1
1: 0
2: 0
3: 16
4: 280
Right 1064385481 10:14887366-14887388 AGACAGTATTACTGTTCACCAGG No data
1064385477_1064385482 28 Left 1064385477 10:14887323-14887345 CCAGGTCTAGGAAAATACAGGTT 0: 1
1: 0
2: 0
3: 16
4: 280
Right 1064385482 10:14887374-14887396 TTACTGTTCACCAGGAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064385477 Original CRISPR AACCTGTATTTTCCTAGACC TGG (reversed) Intronic
901537169 1:9890044-9890066 AACCTGCATGTTCCTATAACTGG + Intronic
902236315 1:15059740-15059762 CACCTGGACATTCCTAGACCTGG - Intronic
906963843 1:50437351-50437373 AACATGTATTTTCCTGGAAAGGG - Intergenic
908820774 1:68084277-68084299 AACCTGTATCTTCCTCTTCCTGG + Intergenic
909604372 1:77493723-77493745 CACCTGTATTTTCAAAGTCCAGG + Intronic
910239558 1:85071778-85071800 AACCTGTATCTTCATAGAACGGG - Intronic
910456260 1:87400197-87400219 TAACTGTATTGACCTAGACCAGG - Intergenic
911928821 1:103873727-103873749 AACCTGTGTTTTCATTCACCAGG + Intergenic
913790063 1:122509761-122509783 AACCTTTCTTTTCATAGAGCAGG + Intergenic
913808850 1:122847724-122847746 AACCTTTCTTTTCATAGAGCAGG + Intergenic
913833371 1:123286848-123286870 AACCTTTCTTTTCATAGAGCAGG + Intergenic
913871960 1:123979178-123979200 AACCTTTCTTTTCATAGAGCAGG + Intergenic
913894549 1:124383403-124383425 AACCTTTCTTTTCATAGAGCAGG + Intergenic
913895263 1:124396152-124396174 AACCTTTCTTTTCGTAGAGCAGG + Intergenic
916725501 1:167518807-167518829 AACTTGTATTTGCCTAGAGATGG - Intergenic
918983156 1:191589577-191589599 ATCATGTATTTTCATAGGCCTGG - Intergenic
922227606 1:223659135-223659157 TACCTGTATTTCCTTAGGCCTGG - Intronic
924287239 1:242500269-242500291 AAACTGTATTTTCCAAAAGCTGG - Intronic
924832477 1:247612499-247612521 AACCTGTATTTTCCTTACCATGG + Intergenic
1063370628 10:5520258-5520280 AATCAGTATTTTCCAAGACAAGG - Intergenic
1064385477 10:14887323-14887345 AACCTGTATTTTCCTAGACCTGG - Intronic
1066825343 10:39565787-39565809 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066828289 10:39687583-39687605 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066828365 10:39688943-39688965 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066828495 10:39691322-39691344 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066828685 10:39694720-39694742 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066828850 10:39697778-39697800 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066829023 10:39700836-39700858 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066829191 10:39703896-39703918 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066829529 10:39710013-39710035 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066829702 10:39713072-39713094 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066829829 10:39715452-39715474 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066830133 10:39720889-39720911 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066830263 10:39723269-39723291 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066830434 10:39726328-39726350 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066830698 10:39731084-39731106 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066830861 10:39734142-39734164 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066831029 10:39737200-39737222 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066831200 10:39740258-39740280 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066831369 10:39743316-39743338 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066831535 10:39746375-39746397 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066831704 10:39749434-39749456 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066831875 10:39752490-39752512 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066832041 10:39755550-39755572 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066832209 10:39758608-39758630 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066832377 10:39761668-39761690 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066832548 10:39764724-39764746 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066832680 10:39767103-39767125 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066832858 10:39770161-39770183 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066833029 10:39773220-39773242 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066833194 10:39776279-39776301 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066833363 10:39779335-39779357 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066833528 10:39782394-39782416 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066833697 10:39785451-39785473 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066833863 10:39788509-39788531 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066833978 10:39790548-39790570 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066834149 10:39793605-39793627 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066834380 10:39797682-39797704 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066834551 10:39800739-39800761 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066834725 10:39803797-39803819 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066834894 10:39806854-39806876 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066835060 10:39809908-39809930 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066835227 10:39812962-39812984 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066835531 10:39818400-39818422 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066835870 10:39824515-39824537 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066836041 10:39827573-39827595 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066836207 10:39830629-39830651 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066836281 10:39831988-39832010 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066836444 10:39835044-39835066 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066836613 10:39838100-39838122 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066836869 10:39842514-39842536 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066837001 10:39844894-39844916 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066837133 10:39847273-39847295 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066837204 10:39848633-39848655 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066837374 10:39851690-39851712 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066837585 10:39855430-39855452 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066837754 10:39858487-39858509 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066837925 10:39861543-39861565 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066838093 10:39864601-39864623 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066838260 10:39867658-39867680 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066838431 10:39870716-39870738 AACCTTTCTTTTCCTAGAGCAGG + Intergenic
1066838603 10:39873774-39873796 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066838773 10:39876832-39876854 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066838944 10:39879890-39879912 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066839113 10:39882948-39882970 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066839288 10:39886007-39886029 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066839460 10:39889066-39889088 AACCTTTCTTTTCCTAGAGCAGG + Intergenic
1066839536 10:39890427-39890449 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066839706 10:39893485-39893507 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066839874 10:39896538-39896560 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066840039 10:39899594-39899616 AACCTTTGTTTTCATAGAGCAGG + Intergenic
1066840214 10:39902654-39902676 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066840913 10:39915232-39915254 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066841080 10:39918288-39918310 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066841246 10:39921347-39921369 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066841418 10:39924405-39924427 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066841591 10:39927460-39927482 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066926205 10:41694761-41694783 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066926240 10:41695440-41695462 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066926377 10:41697819-41697841 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066926412 10:41698498-41698520 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1066926582 10:41701556-41701578 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1068119905 10:52774766-52774788 ACCCTGAAATTTCCTAGAACTGG + Intergenic
1068825330 10:61431694-61431716 ACACTGTAATTTCCTTGACCAGG - Intronic
1071969870 10:90893270-90893292 AACTTGTCTTTTTCTAGAACTGG - Intronic
1074647114 10:115469310-115469332 TACCTGTATTTTAATAGGCCAGG - Exonic
1081137346 11:39454733-39454755 ATCCTGTATTTTGCTAGTCTGGG + Intergenic
1083130394 11:60619889-60619911 AACATGTATTTTCCAAGGGCAGG + Intergenic
1083136802 11:60686340-60686362 AACCTGTATTTTACTTGATTAGG + Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1090055639 11:123421954-123421976 AATCTGTATTTTCATACATCAGG + Intergenic
1090807306 11:130210530-130210552 GACCTGTAGCTTCCAAGACCAGG + Intergenic
1095032029 12:37299977-37299999 AACCTTTCTTTTGATAGACCAGG + Intergenic
1095032201 12:37303552-37303574 AACTTTTCTTTTCATAGACCAGG + Intergenic
1095047432 12:37523297-37523319 AACCTGTATTTTGCTTCAGCAGG - Intergenic
1096439022 12:51623105-51623127 ATCTTGTATTTTCCTTGCCCCGG + Intronic
1101094532 12:101323656-101323678 AACTTGTATTTTCTAAAACCAGG + Intronic
1102816844 12:115872932-115872954 AACCTGGATTTGCAGAGACCTGG - Intergenic
1107301239 13:38968010-38968032 AACCTCTATTTTCATAAAGCTGG - Intronic
1109550146 13:63884784-63884806 TTCCTGTTTTTTCCTAGAACTGG + Intergenic
1113162985 13:107403983-107404005 AACCTGTATTTTCATGCATCAGG + Intronic
1114000597 14:18238473-18238495 AACCTTTCTTTTCATAGAGCAGG - Intergenic
1114000735 14:18240867-18240889 AACCTTTCTTTTCATAGAGCAGG - Intergenic
1114000758 14:18241209-18241231 AACCTTTCTTTTCATAGAGCAGG - Intergenic
1114000832 14:18242571-18242593 AACCTCTCTTTTCATAGAGCAGG - Intergenic
1114000842 14:18242741-18242763 AACCTTTATTTTGGTAGAGCAGG - Intergenic
1114398231 14:22386186-22386208 AACCTATATTGTGCCAGACCTGG - Intergenic
1117065588 14:52010698-52010720 ACCTTGTCTTTTCCTAGAACAGG + Intronic
1118923705 14:70172633-70172655 AGCCTGTGATTTGCTAGACCTGG + Intronic
1119845838 14:77829071-77829093 ATCCTGTATTTTCCTTGTCCTGG + Intronic
1122218229 14:100218428-100218450 AACCGCTGTTTTCCTAGCCCCGG + Intergenic
1123385470 15:19794327-19794349 AACCTTTATTTTGATAGAGCAGG - Intergenic
1124480661 15:30076359-30076381 TTCCTGTATTTTCCTACTCCAGG + Intergenic
1125505780 15:40266761-40266783 AAGCTGGATTTGCCTAGTCCAGG + Intronic
1127757759 15:62109995-62110017 ACCCTGTAATTCTCTAGACCTGG - Intergenic
1129928405 15:79386106-79386128 AACCTGTATTTTCCAAGGGCTGG + Intronic
1132371439 15:101302113-101302135 AACCTGTCATTTCCCAGACAAGG - Intronic
1137046995 16:35674928-35674950 AACCTGTGTTTTGATTGACCAGG + Intergenic
1137050525 16:35709004-35709026 AACCTGTGTTTTGATACACCAGG + Intergenic
1143972526 17:10805837-10805859 AACCTGTATATGGCTAGACCAGG - Intergenic
1144044949 17:11447036-11447058 AACCTGTCTTTTCTCAGAGCAGG + Intronic
1147610983 17:41801673-41801695 GTCCTGTATTTTCCTAGTTCAGG - Intergenic
1148674191 17:49435451-49435473 AATCTGTATTTCCATAGAGCTGG - Intronic
1148752346 17:49952465-49952487 AAACTATATTTTCCTAGGCTTGG - Intergenic
1149785016 17:59427238-59427260 AACATGGATTTTCCTAAAACTGG - Intergenic
1149952624 17:61006313-61006335 AAAGTGTATTTTCTTAGATCTGG - Intronic
1151691413 17:75688314-75688336 AACCTTTATTCTCTCAGACCTGG - Intronic
1153043080 18:832321-832343 AACCTGTAGCTTCCGAGTCCTGG + Intergenic
1159952054 18:74491829-74491851 AACATGTATTTTCCTACTCCTGG + Intergenic
1160465700 18:79074203-79074225 AAGGTGGATTTTCCTAGGCCTGG + Intronic
1164379748 19:27721987-27722009 AACCTGTGTTTTACTTCACCAGG - Intergenic
1166158931 19:40937188-40937210 GACCTGTGTTTTCCTTGCCCTGG + Intergenic
926334016 2:11849780-11849802 AATCTGTGTTTTACTAAACCGGG + Intergenic
927330770 2:21860769-21860791 AACCTCTATTATCCTATAGCAGG - Intergenic
929435682 2:41926838-41926860 AAGCTGTTCTTTCCTAGAGCTGG + Intergenic
930312917 2:49764416-49764438 CACATGGTTTTTCCTAGACCTGG + Intergenic
931766888 2:65464772-65464794 AACCAGCTGTTTCCTAGACCTGG - Intergenic
934470896 2:94533693-94533715 AACCTTTATTTTGATAGAGCAGG - Intergenic
937570868 2:123359494-123359516 AACATATTATTTCCTAGACCAGG - Intergenic
937823081 2:126334186-126334208 TGCAGGTATTTTCCTAGACCTGG + Intergenic
938141709 2:128799886-128799908 AACCTGTTTTGTCCTAGTCCAGG + Intergenic
940246944 2:151629116-151629138 AAGGTGGATTTTCCTAGACTTGG + Intronic
940616896 2:156060015-156060037 AATCTGTTTTATCCTGGACCAGG - Intergenic
941067750 2:160922201-160922223 AAACTGTAGCTTCCTAGAGCAGG - Intergenic
946129515 2:217595082-217595104 AAAATGTATGTTCCTATACCAGG + Intronic
1171799075 20:29593557-29593579 AACCTGTGTTTTCCTTCAGCAGG + Intergenic
1171844974 20:30262911-30262933 AACCTGTGTTTTCCTTCAGCAGG - Intergenic
1175009681 20:55722473-55722495 AAACTGAATTTTTCTACACCGGG - Intergenic
1176762722 21:12972968-12972990 AACCTTTATTTTGATAGAGCAGG - Intergenic
1176762914 21:12976696-12976718 AACCTCTCTTTTCATAGAGCAGG - Intergenic
1176951886 21:15057556-15057578 AGCCTGGATTCTCCAAGACCAGG - Intronic
1177089223 21:16745749-16745771 AATCTTGATTTTCCTAGCCCTGG + Intergenic
1179427723 21:41295229-41295251 TACCTCAATTTTCCTACACCTGG - Intergenic
1180425111 22:15169272-15169294 AACCTTTCTTTTCATAGAGCAGG - Intergenic
1180425248 22:15171665-15171687 AACCTTTCTTTTCATAGAGCAGG - Intergenic
1180425270 22:15172007-15172029 AACCTTTCTTTTCATAGAGCAGG - Intergenic
1180425343 22:15173369-15173391 AACCTCTCTTTTCATAGAGCAGG - Intergenic
1180425353 22:15173539-15173561 AACCTTTATTTTGGTAGAACAGG - Intergenic
1180505703 22:15998865-15998887 AACCTTTCTTTTCATAGAGCAGG - Intergenic
1180505774 22:16000229-16000251 AACCTCTCTTTTCATAGAGCAGG - Intergenic
1180505795 22:16000570-16000592 AACCTTTCTTTTCATAGAGCAGG - Intergenic
1182528836 22:30939871-30939893 AAGCTGTGTTTTACTTGACCAGG + Intronic
1183091214 22:35523413-35523435 CACCTGTCTCTTCCTACACCCGG + Intergenic
1184724205 22:46333978-46334000 AACCTTTGTCTTCCTAGGCCGGG + Intronic
1203332863 22_KI270739v1_random:21477-21499 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1203332884 22_KI270739v1_random:21818-21840 AACCTCTCTTTTCATAGAGCAGG + Intergenic
1203332955 22_KI270739v1_random:23182-23204 AACCTTTCTTTTCATAGAGCAGG + Intergenic
952206704 3:31187495-31187517 ACCCTGCCTTTTCCTAGCCCGGG - Intergenic
952405000 3:32997596-32997618 AACCTGTATTTTCCTGAAGCAGG - Intronic
956184940 3:66553462-66553484 AAAATGTAATTCCCTAGACCAGG + Intergenic
957491758 3:80936269-80936291 AAGCTGAAATTTCCTAGAACAGG + Intergenic
957493345 3:80958421-80958443 AACCTGTATTTTGATTCACCAGG - Intergenic
958242948 3:91105866-91105888 AACCTTTCTTTTGATAGACCAGG + Intergenic
958250357 3:91229898-91229920 AACCTTTCTTTTGATAGACCAGG + Intergenic
958251274 3:91244956-91244978 AACCTTTCTTTTGATAGACCAGG + Intergenic
960370820 3:116836389-116836411 ATCCTGTATAGTTCTAGACCAGG - Intronic
960968063 3:123119290-123119312 AACTTTTATATTTCTAGACCTGG - Intronic
962111289 3:132451924-132451946 TACCTGTATGTTCCTAGATGAGG - Intronic
963381387 3:144534748-144534770 ACCTAGAATTTTCCTAGACCAGG - Intergenic
963833257 3:150031411-150031433 CACCTGCATTTTCCAAGTCCAGG + Intronic
964505203 3:157391447-157391469 AAACTGCACTTTCCCAGACCTGG + Intronic
964998006 3:162911633-162911655 AACCACTATTTTCCTAAAACTGG + Intergenic
965935568 3:174106001-174106023 AATCTATATTTTACTTGACCCGG + Intronic
967503083 3:190222684-190222706 ACCCTGGATTTTCCAGGACCTGG + Intergenic
968266626 3:197367891-197367913 AACCCGTCTCTTTCTAGACCGGG - Intergenic
970080353 4:12276814-12276836 AACCTGTATTTTGATGCACCAGG - Intergenic
970117136 4:12710149-12710171 ACCATGTATTCTCATAGACCTGG + Intergenic
971923285 4:32971654-32971676 AATCTGTATTTTCCTGCACTTGG + Intergenic
972216428 4:36902774-36902796 AAACTGAATTTTTCAAGACCTGG + Intergenic
973151767 4:46897234-46897256 AACCTTTATTTTACAAGAGCTGG - Intronic
974116671 4:57587526-57587548 GCCATGTATTTTCCAAGACCAGG + Intergenic
974274876 4:59705792-59705814 AATCTGTTGTTTCCTATACCAGG - Intergenic
978353456 4:107844835-107844857 AATCTGTATTTGACTATACCTGG - Intronic
980662211 4:135876791-135876813 AACCTGTACATTCCTTGATCTGG - Intergenic
982109303 4:152039214-152039236 AGCCTGTATTTTCCTAGATGAGG - Intergenic
987891756 5:23887785-23887807 AACCTGTGTTTTGATACACCAGG + Intergenic
987892029 5:23891693-23891715 AACCTGTGTTTTCATTCACCAGG + Intergenic
987892912 5:23904990-23905012 AACCTGTGTTTTCATTCACCAGG + Intergenic
988931252 5:36037667-36037689 AAACTGTATTTTCCAGGACATGG - Intronic
989610532 5:43286403-43286425 AACCTGGATTTTCCTAGTGTGGG - Intergenic
991546876 5:67792048-67792070 AAGCAGTATTCTCCTAGACTTGG + Intergenic
995923986 5:117347030-117347052 ATTTTGTATTTTCCTAGACCTGG - Intergenic
999476306 5:151902082-151902104 AACCTATATTTTCCAATTCCCGG - Intronic
1001666643 5:173438617-173438639 AACCTGCATTTTCCTCGCCTGGG - Intergenic
1001884838 5:175280132-175280154 GACCTGTATTTTACAAGACGAGG - Intergenic
1003810581 6:9775326-9775348 AATCTGTATCTGCCTAGACCAGG - Intronic
1005154264 6:22785658-22785680 AACCTGTTTTTTCCTGGACAGGG + Intergenic
1011234835 6:85204337-85204359 AATCTGTTTTTTCAGAGACCAGG - Intergenic
1013963656 6:115929679-115929701 AACATTTATTTTCCAATACCTGG + Intergenic
1014658766 6:124139843-124139865 AACTTGTATTTTCCAAGAAAAGG - Intronic
1014799949 6:125767541-125767563 AACATGCATTTTCCTAGATATGG - Intergenic
1016924133 6:149325005-149325027 AAGCAGTATTTTCCTAGCCTGGG - Intronic
1017615854 6:156245535-156245557 ACCTTGTATTTTCCTTGCCCTGG - Intergenic
1019859631 7:3645660-3645682 AAACTGTACTTTCTTAGACATGG - Intronic
1020143543 7:5625351-5625373 CACATTTATTTTCCTAGACACGG + Intronic
1023179878 7:37470929-37470951 AACCAGTATTTACCGAGAGCTGG - Intergenic
1023656507 7:42427789-42427811 AAACTGTAATTACCCAGACCTGG - Intergenic
1024373631 7:48614325-48614347 AATCAGTATTTTCTTATACCAGG - Intronic
1025326899 7:58237649-58237671 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025328748 7:58270358-58270380 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025336222 7:58402170-58402192 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025338864 7:58449179-58449201 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025341040 7:58487679-58487701 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025341238 7:58491086-58491108 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025347796 7:58607252-58607274 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025365093 7:58913970-58913992 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025368521 7:58974609-58974631 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025369776 7:58996752-58996774 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025380080 7:59179695-59179717 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025387344 7:59308455-59308477 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025410680 7:59722204-59722226 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025419448 7:59877908-59877930 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025448806 7:60399854-60399876 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1025452628 7:60467647-60467669 AACCTTTCTTTTCTTAGAGCAGG + Intergenic
1028075767 7:86513415-86513437 AACCTGTCTTTAGCTAGACTAGG - Intergenic
1028338394 7:89686913-89686935 AACCTGAATTTAGCTAGAGCTGG + Intergenic
1029524377 7:101086092-101086114 CACCTGTCTTCTGCTAGACCTGG - Intronic
1030309192 7:108052487-108052509 AGCCTTTATTCTACTAGACCTGG - Intronic
1030411425 7:109185194-109185216 ACCCTATTTTTTCCTAGACCTGG - Intergenic
1030949971 7:115777966-115777988 GAAATGCATTTTCCTAGACCGGG - Intergenic
1032541531 7:132706804-132706826 AACCTGTATTTACCTACAATGGG - Intronic
1032985465 7:137332307-137332329 AACATGTATTTTTCTAGAATGGG + Intronic
1034945165 7:155257485-155257507 AGCCTGTATTTTCCTTGGCACGG + Intergenic
1035651611 8:1269985-1270007 AACCGGTATTTTCCTGGGCGGGG + Intergenic
1037187443 8:16080925-16080947 AACCTGTATTGGCCCAGATCAGG - Intergenic
1037402531 8:18507250-18507272 AACTTTTATTTTCATAGACAGGG - Intergenic
1038174811 8:25171033-25171055 AACCTGTACTATCCTAGAAAAGG - Intergenic
1040695825 8:49997092-49997114 AAGCTGTATTTACCTAAACTAGG + Intronic
1041798720 8:61774719-61774741 AGCCTGCATTTTCCTGGACATGG + Intergenic
1046663909 8:116978168-116978190 AACCAGTATGTTGATAGACCAGG - Intronic
1050459626 9:5866595-5866617 AACTTGTAATTTCATAGAACTGG + Intergenic
1050636600 9:7619251-7619273 AAACTGTCTTTTCCTGGCCCTGG - Intergenic
1053712362 9:40830822-40830844 AACCTTTCTTTTGATAGACCAGG + Intergenic
1053712716 9:40837470-40837492 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1053712761 9:40838322-40838344 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1053712781 9:40838663-40838685 AACCTCTCTTTTCATAGAGCAGG + Intergenic
1054422902 9:64964070-64964092 AACCTTTCTTTTGATAGACCAGG + Intergenic
1054423246 9:64970717-64970739 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1054423290 9:64971570-64971592 AACCTTTCTTTTCATAGAGCAGG + Intergenic
1054423310 9:64971911-64971933 AACCTCTCTTTTCATAGAGCAGG + Intergenic
1057153255 9:92814283-92814305 AATTAGTATTTTCCTACACCTGG - Intergenic
1057292082 9:93813216-93813238 CACCTGTAATTTGCTAGCCCTGG - Intergenic
1187217578 X:17291649-17291671 AACCAGAATTGTCCTGGACCAGG - Intergenic
1187329983 X:18328970-18328992 GACCTGTGTTTGCCTAGAGCTGG + Intronic
1188807609 X:34611266-34611288 CACTTGTATTTTCCTAAACATGG - Intergenic
1191227782 X:58063444-58063466 AACCTGTGTTTTCATTGACCAGG - Intergenic
1191227885 X:58064775-58064797 AACCTGTGTTTTGGTTGACCAGG - Intergenic
1191228719 X:58076005-58076027 AACCTGTGTTTTGATAGAGCAGG - Intergenic
1191231009 X:58094596-58094618 AACCTGTATTTTCATTCACCAGG + Intergenic
1191231091 X:58095898-58095920 AACCTGTATTTTGATTCACCAGG + Intergenic
1191239020 X:58164877-58164899 AACTTGAATTTTCCTTCACCAGG + Intergenic
1191239106 X:58166078-58166100 AAACTGTGTTTTGCTACACCAGG + Intergenic
1191240303 X:58184328-58184350 AACCTGTATTTTGATTCACCAGG + Intergenic
1194036755 X:88884437-88884459 AAAATGTATTTCCCTGGACCAGG - Intergenic
1197517016 X:127445147-127445169 AAACTGTCTTTTCCTATAACGGG + Intergenic
1197762053 X:130034896-130034918 ATGCAGTATATTCCTAGACCAGG + Intronic
1202115696 Y:21467612-21467634 AGCCTGTATTTGCTTAGGCCTGG + Intergenic