ID: 1064394683

View in Genome Browser
Species Human (GRCh38)
Location 10:14972102-14972124
Sequence AAGAATCCATTGAACTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25427
Summary {0: 1, 1: 3, 2: 63, 3: 1739, 4: 23621}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064394683_1064394687 3 Left 1064394683 10:14972102-14972124 CCTCCAGAGTTCAATGGATTCTT 0: 1
1: 3
2: 63
3: 1739
4: 23621
Right 1064394687 10:14972128-14972150 CCTCAGCCCCCTGAGTACCTGGG 0: 25
1: 2834
2: 108237
3: 212711
4: 243525
1064394683_1064394685 2 Left 1064394683 10:14972102-14972124 CCTCCAGAGTTCAATGGATTCTT 0: 1
1: 3
2: 63
3: 1739
4: 23621
Right 1064394685 10:14972127-14972149 GCCTCAGCCCCCTGAGTACCTGG 0: 23
1: 2288
2: 94523
3: 200942
4: 233994
1064394683_1064394691 11 Left 1064394683 10:14972102-14972124 CCTCCAGAGTTCAATGGATTCTT 0: 1
1: 3
2: 63
3: 1739
4: 23621
Right 1064394691 10:14972136-14972158 CCCTGAGTACCTGGGATTATAGG 0: 2
1: 163
2: 7694
3: 76371
4: 169148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064394683 Original CRISPR AAGAATCCATTGAACTCTGG AGG (reversed) Intronic
Too many off-targets to display for this crispr