ID: 1064397014

View in Genome Browser
Species Human (GRCh38)
Location 10:14990361-14990383
Sequence GTGTACACACACTTCGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064397014_1064397019 10 Left 1064397014 10:14990361-14990383 CCAATATCGAAGTGTGTGTACAC No data
Right 1064397019 10:14990394-14990416 ATATGGTTTTTAATATCCAGTGG No data
1064397014_1064397022 15 Left 1064397014 10:14990361-14990383 CCAATATCGAAGTGTGTGTACAC No data
Right 1064397022 10:14990399-14990421 GTTTTTAATATCCAGTGGGCGGG No data
1064397014_1064397020 11 Left 1064397014 10:14990361-14990383 CCAATATCGAAGTGTGTGTACAC No data
Right 1064397020 10:14990395-14990417 TATGGTTTTTAATATCCAGTGGG No data
1064397014_1064397023 18 Left 1064397014 10:14990361-14990383 CCAATATCGAAGTGTGTGTACAC No data
Right 1064397023 10:14990402-14990424 TTTAATATCCAGTGGGCGGGAGG No data
1064397014_1064397021 14 Left 1064397014 10:14990361-14990383 CCAATATCGAAGTGTGTGTACAC No data
Right 1064397021 10:14990398-14990420 GGTTTTTAATATCCAGTGGGCGG No data
1064397014_1064397015 -7 Left 1064397014 10:14990361-14990383 CCAATATCGAAGTGTGTGTACAC No data
Right 1064397015 10:14990377-14990399 TGTACACGCCCCTTGTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064397014 Original CRISPR GTGTACACACACTTCGATAT TGG (reversed) Intergenic
No off target data available for this crispr