ID: 1064397015

View in Genome Browser
Species Human (GRCh38)
Location 10:14990377-14990399
Sequence TGTACACGCCCCTTGTGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064397010_1064397015 28 Left 1064397010 10:14990326-14990348 CCGAATATCCAAAGAGGGAGAGG No data
Right 1064397015 10:14990377-14990399 TGTACACGCCCCTTGTGATATGG No data
1064397014_1064397015 -7 Left 1064397014 10:14990361-14990383 CCAATATCGAAGTGTGTGTACAC No data
Right 1064397015 10:14990377-14990399 TGTACACGCCCCTTGTGATATGG No data
1064397013_1064397015 20 Left 1064397013 10:14990334-14990356 CCAAAGAGGGAGAGGATGGTATT No data
Right 1064397015 10:14990377-14990399 TGTACACGCCCCTTGTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064397015 Original CRISPR TGTACACGCCCCTTGTGATA TGG Intergenic
No off target data available for this crispr