ID: 1064397019

View in Genome Browser
Species Human (GRCh38)
Location 10:14990394-14990416
Sequence ATATGGTTTTTAATATCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064397014_1064397019 10 Left 1064397014 10:14990361-14990383 CCAATATCGAAGTGTGTGTACAC No data
Right 1064397019 10:14990394-14990416 ATATGGTTTTTAATATCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064397019 Original CRISPR ATATGGTTTTTAATATCCAG TGG Intergenic
No off target data available for this crispr