ID: 1064397020

View in Genome Browser
Species Human (GRCh38)
Location 10:14990395-14990417
Sequence TATGGTTTTTAATATCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064397014_1064397020 11 Left 1064397014 10:14990361-14990383 CCAATATCGAAGTGTGTGTACAC No data
Right 1064397020 10:14990395-14990417 TATGGTTTTTAATATCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064397020 Original CRISPR TATGGTTTTTAATATCCAGT GGG Intergenic
No off target data available for this crispr