ID: 1064397022

View in Genome Browser
Species Human (GRCh38)
Location 10:14990399-14990421
Sequence GTTTTTAATATCCAGTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064397014_1064397022 15 Left 1064397014 10:14990361-14990383 CCAATATCGAAGTGTGTGTACAC No data
Right 1064397022 10:14990399-14990421 GTTTTTAATATCCAGTGGGCGGG No data
1064397016_1064397022 -9 Left 1064397016 10:14990385-14990407 CCCCTTGTGATATGGTTTTTAAT No data
Right 1064397022 10:14990399-14990421 GTTTTTAATATCCAGTGGGCGGG No data
1064397017_1064397022 -10 Left 1064397017 10:14990386-14990408 CCCTTGTGATATGGTTTTTAATA No data
Right 1064397022 10:14990399-14990421 GTTTTTAATATCCAGTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064397022 Original CRISPR GTTTTTAATATCCAGTGGGC GGG Intergenic
No off target data available for this crispr