ID: 1064397023

View in Genome Browser
Species Human (GRCh38)
Location 10:14990402-14990424
Sequence TTTAATATCCAGTGGGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064397016_1064397023 -6 Left 1064397016 10:14990385-14990407 CCCCTTGTGATATGGTTTTTAAT No data
Right 1064397023 10:14990402-14990424 TTTAATATCCAGTGGGCGGGAGG No data
1064397018_1064397023 -8 Left 1064397018 10:14990387-14990409 CCTTGTGATATGGTTTTTAATAT No data
Right 1064397023 10:14990402-14990424 TTTAATATCCAGTGGGCGGGAGG No data
1064397014_1064397023 18 Left 1064397014 10:14990361-14990383 CCAATATCGAAGTGTGTGTACAC No data
Right 1064397023 10:14990402-14990424 TTTAATATCCAGTGGGCGGGAGG No data
1064397017_1064397023 -7 Left 1064397017 10:14990386-14990408 CCCTTGTGATATGGTTTTTAATA No data
Right 1064397023 10:14990402-14990424 TTTAATATCCAGTGGGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064397023 Original CRISPR TTTAATATCCAGTGGGCGGG AGG Intergenic
No off target data available for this crispr