ID: 1064399799

View in Genome Browser
Species Human (GRCh38)
Location 10:15012037-15012059
Sequence CCTCATCTCCAGAGGAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064399791_1064399799 17 Left 1064399791 10:15011997-15012019 CCAATATCGCAGGGGGTGTACAC No data
Right 1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG No data
1064399794_1064399799 -9 Left 1064399794 10:15012023-15012045 CCTGTGAAAATCTTCCTCATCTC No data
Right 1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG No data
1064399792_1064399799 -7 Left 1064399792 10:15012021-15012043 CCCCTGTGAAAATCTTCCTCATC No data
Right 1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG No data
1064399793_1064399799 -8 Left 1064399793 10:15012022-15012044 CCCTGTGAAAATCTTCCTCATCT No data
Right 1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG No data
1064399789_1064399799 21 Left 1064399789 10:15011993-15012015 CCTCCCAATATCGCAGGGGGTGT No data
Right 1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG No data
1064399790_1064399799 18 Left 1064399790 10:15011996-15012018 CCCAATATCGCAGGGGGTGTACA 0: 162
1: 699
2: 1290
3: 1803
4: 1767
Right 1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064399799 Original CRISPR CCTCATCTCCAGAGGAAGAG GGG Intergenic
No off target data available for this crispr