ID: 1064401853

View in Genome Browser
Species Human (GRCh38)
Location 10:15028110-15028132
Sequence CCTTTTAAGCAGTCAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064401853_1064401858 13 Left 1064401853 10:15028110-15028132 CCAGCCACTGACTGCTTAAAAGG No data
Right 1064401858 10:15028146-15028168 TGTCTGGTGCTCAGACTTTCTGG No data
1064401853_1064401857 -3 Left 1064401853 10:15028110-15028132 CCAGCCACTGACTGCTTAAAAGG No data
Right 1064401857 10:15028130-15028152 AGGTGGCTTCTTTCTTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064401853 Original CRISPR CCTTTTAAGCAGTCAGTGGC TGG (reversed) Intergenic
No off target data available for this crispr