ID: 1064402915

View in Genome Browser
Species Human (GRCh38)
Location 10:15036146-15036168
Sequence CTGTGGTTATAGCTATTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064402913_1064402915 29 Left 1064402913 10:15036094-15036116 CCAGACGCTGATTAACTGTACGT 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1064402915 10:15036146-15036168 CTGTGGTTATAGCTATTTCCTGG No data
1064402912_1064402915 30 Left 1064402912 10:15036093-15036115 CCCAGACGCTGATTAACTGTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1064402915 10:15036146-15036168 CTGTGGTTATAGCTATTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064402915 Original CRISPR CTGTGGTTATAGCTATTTCC TGG Intronic
No off target data available for this crispr