ID: 1064402915 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:15036146-15036168 |
| Sequence | CTGTGGTTATAGCTATTTCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064402913_1064402915 | 29 | Left | 1064402913 | 10:15036094-15036116 | CCAGACGCTGATTAACTGTACGT | 0: 1 1: 0 2: 0 3: 1 4: 21 |
||
| Right | 1064402915 | 10:15036146-15036168 | CTGTGGTTATAGCTATTTCCTGG | No data | ||||
| 1064402912_1064402915 | 30 | Left | 1064402912 | 10:15036093-15036115 | CCCAGACGCTGATTAACTGTACG | 0: 1 1: 0 2: 0 3: 1 4: 24 |
||
| Right | 1064402915 | 10:15036146-15036168 | CTGTGGTTATAGCTATTTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064402915 | Original CRISPR | CTGTGGTTATAGCTATTTCC TGG | Intronic | ||
| No off target data available for this crispr | |||||