ID: 1064405111

View in Genome Browser
Species Human (GRCh38)
Location 10:15054728-15054750
Sequence ACTTTGCATCCACTGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064405109_1064405111 19 Left 1064405109 10:15054686-15054708 CCTAGCTCTTTTGCTTGTACTCC 0: 1
1: 0
2: 2
3: 15
4: 163
Right 1064405111 10:15054728-15054750 ACTTTGCATCCACTGTGTTGTGG No data
1064405110_1064405111 -2 Left 1064405110 10:15054707-15054729 CCATATCTAATTCAATACAGCAC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1064405111 10:15054728-15054750 ACTTTGCATCCACTGTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064405111 Original CRISPR ACTTTGCATCCACTGTGTTG TGG Intronic
No off target data available for this crispr