ID: 1064408355

View in Genome Browser
Species Human (GRCh38)
Location 10:15084245-15084267
Sequence CAGCAGTCCGTGAGGCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064408355_1064408364 29 Left 1064408355 10:15084245-15084267 CCACGGGGCCTCACGGACTGCTG 0: 1
1: 0
2: 0
3: 7
4: 200
Right 1064408364 10:15084297-15084319 TTAAGTACATCCTTGTTGGATGG No data
1064408355_1064408363 25 Left 1064408355 10:15084245-15084267 CCACGGGGCCTCACGGACTGCTG 0: 1
1: 0
2: 0
3: 7
4: 200
Right 1064408363 10:15084293-15084315 TCTATTAAGTACATCCTTGTTGG No data
1064408355_1064408361 -4 Left 1064408355 10:15084245-15084267 CCACGGGGCCTCACGGACTGCTG 0: 1
1: 0
2: 0
3: 7
4: 200
Right 1064408361 10:15084264-15084286 GCTGGTGGGTGGCGTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064408355 Original CRISPR CAGCAGTCCGTGAGGCCCCG TGG (reversed) Intronic
900405890 1:2492851-2492873 CACGAGTCCCTGAGGCCCGGGGG + Intronic
900565940 1:3331869-3331891 CCGGAGTCCCTGAGGCCCCCCGG - Intronic
902318814 1:15645139-15645161 CAGCACTCTGGGAGGCCTCGTGG - Intronic
903035705 1:20491364-20491386 CAGCAGTGCGTGAGGACCAATGG + Intergenic
904803921 1:33117931-33117953 CAGCAGCCTGTGGGGCCCGGCGG + Exonic
905899814 1:41574083-41574105 CAGCAGTCTGTGTGTGCCCGGGG - Intronic
907165418 1:52406238-52406260 CAGCACTCTGGGAGGCCCGGGGG - Intronic
907524223 1:55044724-55044746 CTGCAGACAGTGAGGCCCCACGG + Intronic
910162348 1:84287419-84287441 CAGCAGGCAGTCAGGCCCAGTGG - Intergenic
911609110 1:99941206-99941228 CAGCACTTTGTGAGGCCCGGCGG + Intergenic
911670669 1:100604029-100604051 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
917391807 1:174545362-174545384 TAGCAGTGAGTGAGGCTCCGTGG + Intronic
917914687 1:179689811-179689833 TAGCAGTGAGTGAGGCTCCGTGG + Intronic
919603170 1:199647694-199647716 CAGCAGTGAGTGAGGCTCTGTGG - Intergenic
919852344 1:201681503-201681525 CAGCAGTCCACGAGGCCATGTGG + Intronic
920337843 1:205257123-205257145 GAGCAGCCCGTGAGCCCCAGGGG + Intronic
922726437 1:227925087-227925109 CAGCACTCAGGGAGGTCCCGGGG + Intronic
1064408355 10:15084245-15084267 CAGCAGTCCGTGAGGCCCCGTGG - Intronic
1064785318 10:18888242-18888264 CAGAACTCCCTGAGGCCCCATGG - Intergenic
1065882343 10:30047572-30047594 CAGCACACCGAGAGGCCACGGGG - Exonic
1066644504 10:37592230-37592252 CAACAGTCAGTGAAGACCCGAGG + Intergenic
1069227187 10:65959151-65959173 CAGCAGTGAGTGAGGCTCTGTGG + Intronic
1069247144 10:66220434-66220456 CAGAACTCTGTGTGGCCCCGTGG + Intronic
1069719013 10:70538362-70538384 CAGCAGGCCCTGTGGCTCCGAGG + Exonic
1073238474 10:102037430-102037452 CAGCAGTTTGTGAGGCCAAGGGG - Intronic
1073972604 10:109061416-109061438 CACAACTCTGTGAGGCCCCGTGG - Intergenic
1076492009 10:130868038-130868060 CTGCAGGCTGTGAGGCCCCAGGG + Intergenic
1076553524 10:131304851-131304873 CAACAGTCCGTGAGGATCCTGGG + Intronic
1076647544 10:131963573-131963595 CAGCAGCCAGTGAGGCTCCACGG - Intergenic
1076931155 10:133532827-133532849 AGGCAGTCGGTGAGGTCCCGGGG - Exonic
1078793589 11:14569591-14569613 TAGCAGTGAGTGAGGCTCCGTGG - Intronic
1079116168 11:17641865-17641887 CAGCAGGCAGCGAGGTCCCGCGG - Exonic
1080752686 11:35165449-35165471 AAGCAGCCTGTGAGGCCCAGAGG - Intronic
1081860917 11:46332992-46333014 CAGCCGTCCGGGGGGCGCCGCGG + Intronic
1082134670 11:48533685-48533707 CAGCAATCAGTGAGACTCCGTGG + Intergenic
1083912996 11:65720840-65720862 CGGCTTCCCGTGAGGCCCCGCGG - Exonic
1088214068 11:107488570-107488592 CAACAGTCAGTGAGGCACTGAGG - Intergenic
1090988077 11:131790627-131790649 CAACAGTCTGTGAGGACCCCAGG - Intronic
1095913944 12:47457557-47457579 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
1096359643 12:50972874-50972896 TAGCAATCAGTGAGGCTCCGTGG - Intergenic
1100338499 12:93655650-93655672 AAGCAAACCATGAGGCCCCGGGG - Intergenic
1102981568 12:117245667-117245689 CAGCACTTTGGGAGGCCCCGGGG + Intronic
1106646306 13:31638184-31638206 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
1106737991 13:32607819-32607841 TAGCAGTGAGTGAGGCTCCGTGG + Intronic
1108810612 13:54219319-54219341 TAGCAGTGAGTGAGGCTCCGTGG - Intergenic
1111071281 13:83171528-83171550 TAGCAGTGAGTGAGGCTCCGTGG - Intergenic
1114323464 14:21566632-21566654 CAGCACTCTGGGAGGCCGCGGGG + Intergenic
1115648141 14:35384352-35384374 CAGCAGTGGCTGTGGCCCCGGGG + Intergenic
1116729756 14:48607078-48607100 TAGCAGTGAGTGAGGCTCCGTGG - Intergenic
1117003135 14:51392190-51392212 AAGCAGTCAGTGAGGCTCCTGGG + Intergenic
1118103952 14:62636926-62636948 TAGCAGTCAGTGAGACTCCGTGG - Intergenic
1119951708 14:78752154-78752176 CAGCACTTTGGGAGGCCCCGAGG + Intronic
1122475953 14:102009105-102009127 CAGCTGTCGGAGAGGCCCCAGGG + Intronic
1123040694 14:105489097-105489119 CAGCAGGCCGAGAGGCCTGGGGG + Intronic
1125226804 15:37405088-37405110 TAGCAGTCAGTGAGACTCCGTGG + Intergenic
1129372792 15:75108699-75108721 GGGCAGTCAGTGAGGCCCAGGGG - Intronic
1132458834 16:39341-39363 AGGCAGGCCGTGAGGCCCAGTGG - Intergenic
1136139505 16:28279659-28279681 CAGCTGTCCCTGGGGCCCCTGGG - Intergenic
1136633966 16:31507730-31507752 CAGCAATACGTGAGGCTCCAGGG + Intronic
1136675976 16:31906536-31906558 CAGCAATCAGTGAGACTCCGTGG + Intronic
1137808533 16:51330178-51330200 TAGCAGTAAGTGAGGCTCCGTGG - Intergenic
1138366133 16:56479220-56479242 CAGCACTTTGGGAGGCCCCGAGG + Intronic
1140922355 16:79550980-79551002 CTGCTGTCTGTGAGGCCACGGGG - Intergenic
1141108780 16:81255029-81255051 CAGCAGTTTGAGAGGCCCAGAGG - Intronic
1141884858 16:86884493-86884515 CAGCTCTCCGGGAGGCCCCCTGG - Intergenic
1142156549 16:88535040-88535062 CGGCAGTCCGTGCGGCCTGGGGG - Exonic
1142247231 16:88975730-88975752 CAGCTGCCCGTGGGGCCCCAGGG - Intronic
1143464809 17:7129547-7129569 CACCAGTCTGAGAGGCCCAGAGG + Intergenic
1144373569 17:14616859-14616881 AAGCAGTCAGTGAGTCCCCTTGG + Intergenic
1148002547 17:44398281-44398303 CAGCAGTCAGCCAGGCCCTGTGG - Exonic
1148120926 17:45210696-45210718 CAGCACTCTGGGAGGCCCAGGGG - Intergenic
1148451102 17:47778330-47778352 CAGCAGGCCGGGTGGCCACGGGG + Intergenic
1150723558 17:67633790-67633812 CAGCAGCCCGGGGGGGCCCGAGG - Intronic
1151698655 17:75731094-75731116 TAGCTATCCCTGAGGCCCCGAGG + Intronic
1152020481 17:77777693-77777715 CAGCAGACCGTGAAGGCCCCAGG + Intergenic
1152380732 17:79941214-79941236 CAGGACTCGGTGAGCCCCCGAGG - Intronic
1152660665 17:81540475-81540497 CAGCAGCCCCTGAGGCCAGGAGG - Exonic
1152739682 17:82013445-82013467 CACCACCCCGAGAGGCCCCGAGG - Intronic
1154173280 18:12066403-12066425 CAGCAGTCTGGGAGGCCGAGGGG - Intergenic
1157123427 18:44933708-44933730 TAGCAGTGAGTGAGGCTCCGTGG + Intronic
1157641171 18:49216129-49216151 TAGCAGTCAGTGAGACTCCGTGG - Intronic
1160787375 19:907350-907372 CAGCCCCCCCTGAGGCCCCGGGG + Intronic
1161277992 19:3429664-3429686 CTGCAGTCCGTGCTGCCCCCTGG + Intronic
1161309381 19:3585608-3585630 CAGCGGCCCGGGAGGCCCGGGGG + Exonic
1164627141 19:29737294-29737316 CAGCAGCTCTCGAGGCCCCGGGG - Intergenic
1165160550 19:33813221-33813243 CAGCATCCTCTGAGGCCCCGGGG + Exonic
1165532884 19:36418634-36418656 GCGCAGCCCGTTAGGCCCCGGGG - Exonic
1168412154 19:56146893-56146915 CTGCGGTCCGGGAGGCCCCATGG + Exonic
927447009 2:23171906-23171928 TAGCAGTGAGTGAGGCTCCGTGG - Intergenic
930024990 2:47024382-47024404 CAGCAGCCCCCGAGGACCCGGGG - Intronic
931469233 2:62521286-62521308 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
931762864 2:65432318-65432340 CAGCAGTCCCTGCCGCTCCGAGG - Intronic
931824997 2:65991241-65991263 CATCAGTCTGTGGGGCCCTGTGG + Intergenic
931881736 2:66576503-66576525 AAGCACTCCGTGAGGTTCCGAGG - Intergenic
938087058 2:128408638-128408660 CAGCAGTTCCTGAGGCCTCTGGG + Intergenic
938217472 2:129532255-129532277 TAGCAGTGAGTGAGGCTCCGTGG - Intergenic
941317100 2:164007211-164007233 CAGCAGTTCGGGAGGCCGAGGGG + Intergenic
942360326 2:175165910-175165932 CAGCACTTCGTGAGGCCGAGTGG - Intronic
943628462 2:190224137-190224159 TAGCAGTGAGTGAGGCTCCGTGG - Intronic
944690479 2:202154075-202154097 GAGGAGTCTGGGAGGCCCCGGGG - Intronic
945436088 2:209819154-209819176 CAGGAGTCTGTGAGGCTTCGAGG - Exonic
947412414 2:229855013-229855035 CAGCATTCTGGGAGGCCGCGGGG + Intronic
947612423 2:231532315-231532337 GAGCAGTCCGAAAGTCCCCGTGG + Intergenic
948676468 2:239599965-239599987 CAGCAGCCCGGAAGGCCCTGTGG + Intergenic
948876420 2:240832242-240832264 CAGCAGCCCGCGCGGCCCCGCGG + Intergenic
1168811935 20:710155-710177 CAGCAGACCGGGCGGCCCGGGGG - Intergenic
1176923551 21:14719171-14719193 CAGAAGTGCCTGAAGCCCCGGGG + Intergenic
1178773663 21:35528733-35528755 CAGCAGTGCTGGAGGCCCCCGGG - Intronic
1179108501 21:38424841-38424863 CAGCAGTCCTAGAGGACCCTTGG + Intronic
1179646086 21:42777224-42777246 GAGCAGTCCCTGAGGCCCCACGG + Intergenic
1181753984 22:25009830-25009852 CAGCACTTTGGGAGGCCCCGAGG - Intronic
1183211147 22:36452139-36452161 CAGCACTTCGGGAGGCCCCGAGG + Intergenic
1183593274 22:38794054-38794076 CAGGAGCAGGTGAGGCCCCGGGG - Exonic
1184509714 22:44926325-44926347 GGGCAGGCCGTGGGGCCCCGGGG + Intronic
1184886759 22:47351286-47351308 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
949816896 3:8068383-8068405 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
950837261 3:15932599-15932621 CAGCAGTCTGTGAGGCCTACTGG + Intergenic
952222750 3:31341305-31341327 CAGCAGTGTGTGAGGTCCGGAGG + Intergenic
952514443 3:34090166-34090188 TAGCAGTCAGTGAGACTCCGTGG + Intergenic
952791663 3:37205432-37205454 CAGCACTTTGGGAGGCCCCGAGG + Intergenic
953653119 3:44823778-44823800 TAGCAGTGAGTGAGGCTCCGTGG + Intronic
954744151 3:52777626-52777648 CAGCAGCCCCCGAGGCCCCATGG - Exonic
955427449 3:58806946-58806968 TAGCAGTCAGTGAGACTCCGTGG - Intronic
959735736 3:109655546-109655568 CAGAATTCCGTGCGGCCCCAAGG - Intergenic
959823813 3:110769198-110769220 TAGCAGTGAGTGAGGCTCCGTGG - Intergenic
959949745 3:112166028-112166050 TAGCAGTGAGTGAGGCTCCGTGG + Intronic
961827390 3:129606269-129606291 TAGTTGTCCGTGAGGCGCCGCGG + Exonic
962554091 3:136528338-136528360 TAGCAGTGAGTGAGGCTCCGTGG + Intronic
969568242 4:7992761-7992783 CAGCAGGAGGAGAGGCCCCGGGG - Intronic
970496276 4:16629008-16629030 CAGCAGTCCGTGATGGACCTGGG + Intronic
970758621 4:19455978-19456000 CAGCACTTTGGGAGGCCCCGGGG - Intergenic
976652400 4:87450111-87450133 CAGCACTTTGGGAGGCCCCGGGG - Intronic
979540345 4:121873782-121873804 TAGTAGTCTGTGGGGCCCCGAGG - Intergenic
979589828 4:122465601-122465623 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
979599782 4:122574939-122574961 TAGCAATCAGTGAGGCTCCGTGG + Intergenic
984492521 4:180453303-180453325 CATCAGTCTGTGTGGCCCCCCGG + Intergenic
984704310 4:182836629-182836651 TGGCAGTCCGTGAGGGCCTGTGG - Intergenic
985747867 5:1657338-1657360 CAGCAGTTCGTGGCGCCCCGTGG + Intergenic
987174390 5:15292299-15292321 TAGCAATCAGTGAGACCCCGTGG - Intergenic
989953567 5:50330437-50330459 TAGCAGTCAGTGAGACTCCGTGG - Intergenic
990145493 5:52755906-52755928 CAGCACTCTGGGAGGCCCAGTGG + Intergenic
992208468 5:74453879-74453901 CAGCACTCTGTGAGGCCAAGGGG + Intergenic
998407787 5:141883581-141883603 CAGCGGTCCGTCAGGACCCGAGG - Intergenic
998862174 5:146455066-146455088 CAGCAGGCCTTGAGGTTCCGAGG + Exonic
1001397296 5:171426508-171426530 CAGCAGGTCAGGAGGCCCCGTGG + Intronic
1002081776 5:176741688-176741710 CAGTCTTCTGTGAGGCCCCGGGG - Intergenic
1002216583 5:177639295-177639317 TAGCAATGAGTGAGGCCCCGTGG + Intergenic
1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG + Intergenic
1003690879 6:8352470-8352492 CAGCTGTCCTGGAGGCCCGGTGG + Intergenic
1006153072 6:31999527-31999549 CAGCAGGACGTGGGGCCCCTCGG - Exonic
1006159380 6:32032264-32032286 CAGCAGGACGTGGGGCCCCTCGG - Exonic
1006451999 6:34110737-34110759 CTGCAGCCCGTGAGTCCCCAGGG + Intronic
1006732567 6:36247211-36247233 CAGTAGTCTGTGGGGCCCTGAGG - Intronic
1011348052 6:86392950-86392972 TAGCAGTGAGTGAGGCTCCGTGG - Intergenic
1011760724 6:90562456-90562478 TAGCAGTGAGTGAGGCACCGTGG - Intronic
1013106158 6:107028224-107028246 CTGCAGTCCGCGCGGCCGCGGGG + Exonic
1013244754 6:108275796-108275818 CAGCAGTCTGGGAGGCCAAGGGG - Intergenic
1013998969 6:116343027-116343049 TAGCAGTGAGTGAGGCTCCGTGG - Intronic
1019197079 6:170289309-170289331 CTGCAGGCCGCGGGGCCCCGGGG + Intronic
1019385419 7:753011-753033 AAGCAGTCCGAGAGGCACAGTGG - Intronic
1020600626 7:10270586-10270608 TAGCAATCAGTGAGGCTCCGTGG - Intergenic
1020790231 7:12618101-12618123 CAGCATTCCCTGAGGCCTCTAGG + Intronic
1022000850 7:26224708-26224730 CAGCAATCTGGGAGGCCCAGGGG + Intergenic
1022099497 7:27160855-27160877 CAGCTGTCCGGGCGGCCGCGGGG - Intergenic
1022352666 7:29580300-29580322 TAGCAATCAGTGAGACCCCGTGG - Intergenic
1022362413 7:29674846-29674868 CAGCACTCTGGGAGGCCCAGGGG - Intergenic
1023095231 7:36653655-36653677 CAGCAGTTCAGGAGGCCCCAGGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028646923 7:93108683-93108705 TAGCAGTGAGTGAGGCTCCGTGG - Intronic
1030309941 7:108059023-108059045 CAGCAGTACGACAGGCCTCGGGG - Intronic
1034386086 7:150742462-150742484 AAGCAGGACGTGGGGCCCCGGGG - Exonic
1034536763 7:151730199-151730221 CACCAGGCCGTGTGGCCCCGAGG + Intronic
1035242327 7:157540283-157540305 CAGCACTCAGTGAGGCCGCCCGG - Exonic
1035282688 7:157787524-157787546 AAGCAGGACGTGAGGCCCAGGGG - Intronic
1035293536 7:157854839-157854861 CAGCAGCCCCCAAGGCCCCGAGG - Intronic
1036672271 8:10799360-10799382 CAGTTCTCCTTGAGGCCCCGAGG + Intronic
1036947876 8:13111893-13111915 CAGCAGTTTGGGAGGCCCCAAGG + Intronic
1037599750 8:20384194-20384216 CAGGAGACCGTGCGGCCCGGAGG - Intergenic
1038221732 8:25615117-25615139 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
1039990881 8:42486636-42486658 CATCAGGCAGTGAGGCCCAGAGG - Intronic
1045479348 8:102579854-102579876 CAACAGTCAGTGAGGACCTGAGG + Intergenic
1050322452 9:4467014-4467036 TAGCAGTGAGTGAGGCACCGTGG - Intergenic
1051727496 9:20103075-20103097 TAGCAGTCAGTGAGACTCCGTGG - Intergenic
1051941310 9:22508625-22508647 TAGCAGTAAGTGAGGCTCCGTGG + Intergenic
1052486707 9:29110580-29110602 CAGCACTTTGGGAGGCCCCGAGG - Intergenic
1057324718 9:94050971-94050993 TAGCAGTGAGTGAGGCTCCGTGG + Intronic
1061360067 9:130135736-130135758 CAGCAGCTCCTGAGGCCCAGTGG + Exonic
1061660948 9:132129948-132129970 TAGCAGGCTCTGAGGCCCCGAGG - Intergenic
1062181615 9:135194077-135194099 CAGCTGTCTGTCAGGTCCCGTGG - Intergenic
1062436732 9:136549660-136549682 CAGCAGAACCTGAGGCCCGGCGG - Intergenic
1062530787 9:136998732-136998754 CAGCAGTCTGGGAGGCCGAGGGG + Intergenic
1188272053 X:28152479-28152501 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
1189374387 X:40455341-40455363 CAGCAGCCAATGAGGCCCTGAGG - Intergenic
1189930487 X:46004098-46004120 CAGCAGTGAGTGAGGCTCCGTGG + Intergenic
1190209564 X:48433816-48433838 TAGCAGTGAGTGAGGCTCCGTGG - Intergenic
1190290832 X:48991049-48991071 CAGCTGTCAGTGAGGGCCAGGGG - Exonic
1190840799 X:54142471-54142493 CAGCAGTGAGTGAGGCTCTGTGG - Intronic
1191213083 X:57909647-57909669 CAGCAGTCCGCGGGGGCCCAGGG + Exonic
1191993554 X:67065750-67065772 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
1192910817 X:75602254-75602276 CAGCAATGAGTGAGGCTCCGTGG + Intergenic
1194761755 X:97803674-97803696 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
1195421241 X:104677735-104677757 CAGCAGTCAGCGAGACTCCGTGG + Intronic
1196137964 X:112230287-112230309 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
1196794247 X:119489594-119489616 CAGCAGAGTGTGAGGCCCAGTGG + Intergenic
1196944665 X:120811886-120811908 TAGCAGTGAGTGAGGCTCCGTGG - Intergenic
1198022661 X:132674516-132674538 CTGCAGTCCCTGATGCCCTGTGG - Intronic
1199779009 X:151041204-151041226 TAGCAGTGAGTGAGGCTCCGTGG + Intergenic
1201956535 Y:19629920-19629942 TAGCAGTCAGTGAGGCTCTGTGG + Intergenic